Anti-5-hydroxymethyl Cytidine antibody [AB3/63.3] (ab106918)

Overview

• Product nameAnti-5-hydroxymethyl Cytidine antibody [AB3/63.3]
• Description
  Rat monoclonal [AB3/63.3] to 5-hydroxymethyl Cytidine
• Tested applicationsICC/IF, IP, ChIP, IHC-Fr, Dot Blot, MeDIP more details
• Immunogen

  5-hydroxymethylcytidine conjugated to KLH

Properties

• FormLiquid
• Storage instructionsShipped at 4°C. Upon delivery aliquot and store at -20°C. Avoid freeze / thaw cycles.
• Storage bufferPreservative: 0.05% Sodium Azide
  Constituents: PBS, pH 7.4
• Concentration information loading...
• PurityProtein G purified
• Clonality Monoclonal
• Clone numberAB3/63.3
• IsotypeIgG2a
• Research Areas
  • Epigenetics and Nuclear Signaling
  • DNA / RNA
  • DNA / Nucleotides

  • Epigenetics and Nuclear Signaling
  • DNA methylation
  • Methylated DNA

Applications

Target

• RelevanceCytidine is a nucleoside formed by a cytosine attached to a ribose ring via a ß-N1-glycosidic bond. DNA is methylated on cytidines by DNA methylases (DNMTs)to generate 5-methylcytidine (5-mC), a potent epigenetics marker and regulator of gene expression. The reverse reaction (cytidine demethylation) starts with its oxidation to hydroxymethyl- (5-hmC), formyl- (5-fC), and carboxy- (5-caC) cytidine. Several enzymes, including the Tet family of proteins have been implicated in cytidine demethylation.

• Alternative names
  5 hmC antibody5 hme C antibody5 hydroxy me C antibody

  5 hydroxy me Cytidine antibody5 hydroxy me Cytosine antibody5 hydroxy methyl cytidine antibody5 hydroxy methyl Cytosine antibody5 hydroxymethylcytidine antibody5-hmC antibody5-hme C antibody5-hme-C antibody5-hydroxy-me-C antibody5-hydroxy-methyl-cytidine antibody5-hydroxy-methyl-cytosine antibody5-hydroxymethyl Cytidine antibody5-hydroxymethyl Cytosine antibody5hmC antibody

  see all

Anti-5-hydroxymethyl Cytidine antibody [AB3/63.3] images

• 

  Dot Blot - Anti-5-hydroxymethyl Cytidine antibody [AB3/63.3] (ab106918)
  Dot blot assay shows that ab106918 specifically recognized 5-hydroxymethyl Cytidine (hmC). Indicated amounts of hmC, methyl Cytidine (mC) and Cytidine (C) were spotted onto a membrane that was then incubated with ab106918. hmC, mC and C were generated in the following way: M13mp18 DNA had been amplified using primers F and R; F: atttccatgagcgtttttcc R: gcaaggcaaagaattagcaa. A 200 uM dNTP end concentration was used with 1. A,G,C,T and 2. A,G,hmC,T; where C had been replaced with HmdCTP. DNA was in vitro methylated with SssI and SAM, and 2ul of pmol of each base was denatured at 95C for 5 min and spotted and dried onto the membrane. The dot blot membrane was blocked with 10%skimmed milk + 1%BSA blocking overnight and then incubated with ab106918 at 1:500 in blocking solution. A goat anti rat HRP secondary antibody was used for ECL detection. This image is from an anonymous collaborator.
• 

  Dot Blot - Anti-5-hydroxymethyl Cytidine antibody [AB3/63.3] (ab106918)
  Dot blot competition assay in which ab106918 was preincubated with 5-hydroxymethyl Cytidine (5hmC) at amounts indicated in figure. Specified amounts of 5hmC, methyl Cytidine (mC) and Cytidine (C) were spotted onto membranes and were then incubated with ab106918 that had been preincubated with 5hmC as shown in figure. ab106918 specifically recognized 5hmC and this was blocked by preincubation with 5hmC at 5 pmol/ug ab106918 (Ab). This image is from an anonymous collaborator.
• 

  MeDIP - Anti-5-hydroxymethyl Cytidine antibody [AB3/63.3] (ab106918)
  The specificity of ab106918 was confirmed by (h)MeDIP using qPCR validation of regions in ES cells that are highly enriched in 5-hydroxymethyl Cytidine (5hmC) (Pic1, Pic3 and Pic7) or not (Pic5 and Pic10). This image is from an anonymous collaborator.
• 

  ChIP - Anti-5-hydroxymethyl Cytidine antibody [AB3/63.3] (ab106918)This image is courtesy of an anonymous Abreview
  ChIP analysis of mouse ES nuclear cell lysate using ab106918 to bind 5-hydroxymethyl Cytidine. Chromatin was obtained by incubating with primary antibody (0.5 µg/µg chromatin in a glycerol IP buffer) for 16 hours at 4°C. Protein binding was detected using real-time PCR.

  See Abreview