Anti-5-hydroxymethylcytosine (5-hmC) antibody [AB3/63.3] (ab106918)

Overview

Properties

Applications

Our Abpromise guarantee covers the use of ab106918 in the following tested applications.

The application notes include recommended starting dilutions; optimal dilutions/concentrations should be determined by the end user.

Application Abreviews Notes
ICC/IF 1/500 - 1/1000.
IP 1/200.
ChIP Use at an assay dependent concentration.
IHC-Fr 1/500 - 1/1000.
Dot Blot 1/500.
MeDIP Use at an assay dependent concentration.

Target

  • Relevance5-Hydroxymethylcytosine (5-hmC) is a modified base form of cytosine recently found in Human/mouse brain and inembryonic stem cells. This DNA pyrimidine nitrogen base can be generated by oxidation of 5-methylcytosine, a reaction mediated by the ten-eleven translocation (TET) family of the 5-mC hydroxylases. The function of this base is still not elucidated but it is believed to play an important role in switching genes on and off.
  • Alternative names
    • 5 hmC antibody
    • 5 hme C antibody
    • 5 hydroxy me C antibody
    • 5 hydroxy me Cytidine antibody
    • 5 hydroxy me Cytosine antibody
    • 5 hydroxy methyl cytidine antibody
    • 5 hydroxy methyl Cytosine antibody
    • 5 hydroxymethylcytidine antibody
    • 5-hmC antibody
    • 5-hme C antibody
    • 5-hme-C antibody
    • 5-hydroxy-me-C antibody
    • 5-hydroxy-methyl-cytidine antibody
    • 5-hydroxy-methyl-cytosine antibody
    • 5-hydroxymethyl Cytidine antibody
    • 5-hydroxymethyl Cytosine antibody
    • 5hmC antibody
    see all

Anti-5-hydroxymethylcytosine (5-hmC) antibody [AB3/63.3] images

  • Dot blot assay shows that ab106918 specifically recognized 5-hydroxymethyl Cytidine (hmC). Indicated amounts of hmC, methyl Cytidine (mC) and Cytidine (C) were spotted onto a membrane that was then incubated with ab106918. hmC, mC and C were generated in the following way: M13mp18 DNA had been amplified using primers F and R; F: atttccatgagcgtttttcc R: gcaaggcaaagaattagcaa. A 200 uM dNTP end concentration was used with 1. A,G,C,T and 2. A,G,hmC,T; where C had been replaced with HmdCTP. DNA was in vitro methylated with SssI and SAM, and 2ul of pmol of each base was denatured at 95C for 5 min and spotted and dried onto the membrane. The dot blot membrane was blocked with 10%skimmed milk + 1%BSA blocking overnight and then incubated with ab106918 at 1:500 in blocking solution. A goat anti rat HRP secondary antibody was used for ECL detection. This image is from an anonymous collaborator.
  • Dot blot competition assay in which ab106918 was preincubated with 5-hydroxymethyl Cytidine (5hmC) at amounts indicated in figure. Specified amounts of 5hmC, methyl Cytidine (mC) and Cytidine (C) were spotted onto membranes and were then incubated with ab106918 that had been preincubated with 5hmC as shown in figure. ab106918 specifically recognized 5hmC and this was blocked by preincubation with 5hmC at 5 pmol/ug ab106918 (Ab). This image is from an anonymous collaborator.
  • The specificity of ab106918 was confirmed by (h)MeDIP using qPCR validation of regions in ES cells that are highly enriched in 5-hydroxymethyl Cytidine (5hmC) (Pic1, Pic3 and Pic7) or not (Pic5 and Pic10). This image is from an anonymous collaborator.
  • ChIP analysis of mouse ES nuclear cell lysate using ab106918 to bind 5-hydroxymethyl Cytidine. Chromatin was obtained by incubating with primary antibody (0.5 µg/µg chromatin in a glycerol IP buffer) for 16 hours at 4°C. Protein binding was detected using real-time PCR.

    See Abreview

References for Anti-5-hydroxymethylcytosine (5-hmC) antibody [AB3/63.3] (ab106918)

This product has been referenced in:
  • Ladopoulos V  et al. The Histone Methyltransferase KMT2B Is Required for RNA Polymerase II Association and Protection from DNA Methylation at the MagohB CpG Island Promoter. Mol Cell Biol 33:1383-93 (2013). Read more (PubMed: 23358417) »

See 1 Publication for this product

Product Wall

Both of these kits (ab117133 and ab117135) will immunoprecipitate methylated DNA. The ab117133 Kit uses purified DNA as starting materials while the ab117135 Kit uses cells as starting materials. I can confirm that the immunoprecipitated products are s...

Read More
Abcam guarantees this product to work in the species/application used in this Abreview.
Application ChIP
Sample Mouse Cell lysate - nuclear (Mouse ES cells)
Specification Mouse ES cells
Type Native ChIP (N-ChIP)
Detection step Real-time PCR
Positive control Taf5
Negative control Magoh2
Username

Abcam user community

Verified customer

Submitted Dec 06 2012

Abcam guarantees this product to work in the species/application used in this Abreview.
Application Immunocytochemistry/ Immunofluorescence
Sample Human Cell (HeLa)
Specification HeLa
Fixative Paraformaldehyde
Permeabilization Yes - 0.5% Triton-X100 in PBS
Username

Dr. Kirk McManus

Verified customer

Submitted Feb 10 2012

Thank you for contacting us.


Anti-5-Methyl Cytidine antibody (ab10805) has been tested and is guaranteed in paraffin embedded and frozen section immunohistochemistry. Anti-5-hydroxymethyl Cytidine antibody (ab106918) has only been teste...

Read More

Thank you for contacting us.

To our knowledge, ab106918 has not yet been tested in IHC-P. Your customer would therefore qualify for the testing discount promotion. If your customer would like to take part in this scheme please could you prov...

Read More

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"