EpiSeeker methylated DNA Immunoprecipitation (MeDIP) Kit - DNA (ab117133)

Overview

  • Product nameEpiSeeker methylated DNA Immunoprecipitation (MeDIP) Kit - DNASee all 5-methylcytosine kits ...
  • Assay time
    3h 00m
  • Species reactivity
    Reacts with: Mouse, Human
    Predicted to work with: Rat, a wide range of other species
  • Product overview

    DNA methylation is a covalent modification of the cytosine ring at the 5' position of a CpG dinucleotide which leads to epigenetic inactivation of genes when found in 5'-CpG-3'dinucleotides within promoters or in the first exon of genes. It has been demonstrated that DNA methylation plays an important role in the regulation of gene expression, tumorigenesis, and other genetic and epigenetic diseases, and that alterations in DNA methylation patterns are associated with cancer.

    EpiSeeker methylated DNA Immunoprecipitation (MeDIP) Kit - DNA (ab117133) enables the user to enrich methylated DNA by using an antibody specific to methyl cytosine (5-mC) to immunoprecipitate methylated genomic DNA (MeDIP). The enriched methylated fractions can then be used in various downstream applications including qualitative and quantitative PCR, as well as southern blot and DNA microarray.

  • Notes

    Store EMD1, EMD3, Normal Mouse IgG, Anti-5-Methylcytosine, Proteinase K, and 8-Well Assay Strips at 4°C.

    Store all other components at room temperature.

    The kit is stable for up to 6 months from the shipment date, when stored properly.

    NOTE: the size of this kit is based on number of TESTS not SAMPLES. If you are not sure which size is most suitable for you, contact our Scientific Support Team.

  • Tested applicationsFunctional Studies more details

Properties

    Applications

    Our Abpromise guarantee covers the use of ab117133 in the following tested applications.

    The application notes include recommended starting dilutions; optimal dilutions/concentrations should be determined by the end user.

    Application Notes
    Functional Studies Use at an assay dependent concentration.

    EpiSeeker methylated DNA Immunoprecipitation (MeDIP) Kit - DNA images

    • For enrichment of methylated DNA using ab117133, DNA (0.5 ug) isolated from MCF-7 cells was added into the microwell. Methylated DNA was captured by 5-mC antibody prebound to the microwells.
    • Captured methylated DNA was used for analyzing methylation level of GAPDH and MLH1 promoter with the use of primers and probes specific to GAPDH and MLH1 promoters, respectively.

    Protocols

    References for EpiSeeker methylated DNA Immunoprecipitation (MeDIP) Kit - DNA (ab117133)

    ab117133 has not yet been referenced specifically in any publications.

    Product Wall

    Both of these kits (ab117133 and ab117135) will immunoprecipitate methylated DNA. The ab117133 Kit uses purified DNA as starting materials while the ab117135 Kit uses cells as starting materials. I can confirm that the immunoprecipitated products are s...

    Read More



    Here are the sequences for human H19ICR and GAPDH:

    H19ICR(234 bp length of amplicons):

    F: GAGCCGCACCAGATCTTCAG
    R: TTGGTGGAACACACTGTGATCA

    GAPDH (110 bp length of amplicons)

    F: 5'-ACGTAGCTCAGGCCTCAAGA-3'<...

    Read More

    Thank you for your inquiry.

    With use of this kit, about 40 ng/well of meDNA can be generated from 500 ng of inputgenomic DNA. Thus, at least 20 ug of genomic DNA (in 40 wells) are needed for generating 1.5 ug of methylated DNA.

    Read More

    Thank you for your inquiry.

    You will need 1 well per plate dedicated to the negative control if you're running all at the same time. So for 60 samples you'd probably need to orderone 48 sample kit and one 24 sample kit. The kits are in strip ...

    Read More

    Thank you for contacting us.





    The pre-sonicated DNA sample can be used if the DNA is in the buffer(such as TE containing low concentration of salts) that would not interfereantibody binding to the meDNA, or use MC2 to ...

    Read More

    Thank you for contacting us.
    The elution buffer EMD6 used is RNAse/DNAse free water.
    I hope this information is helpful to you. Please do not hesitate to contact us if you need any more advice or information.
    Use our products? Submit an ...

    Read More

    I am sorry this product did not perform as stated on the datasheet and for the inconvenience this has caused. As requested, I have issued a free of charge replacement for one EpiSeeker methylated DNA Immunoprecipitation (MeDIP) Kit - DNA (ab117133). Read More

    I apologize again for the incorrect information given originally.

    For tissues we recommend, ab117136.
    In comparison, kit ab117135 would be used when starting with cells. When using a DNA sample, please use ab117133 instead.

    I ...

    Read More

    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"