|
ab46666 |
If your product does not perform as described on this datasheet, we will refund or replace your product...
Read our guarantee »This product is covered by the Abpromise guarantee. Our scientific support team are available to answer any questions or queries - fill out an inquiry form for ab12405 for help.
Alternatively, you can search the previous enquiries about this product to see if your query has already been answered.
|
|||||||||
|
|||||||||
Hi, I have a question regarding your anti-SUV39h1 antibody. In your data sheet, the ChIP assy figure demonstrated that you are able to precipitate more DNA from the heterochromatin region. However, I can't find a reference or definition to the "SAT2" or "SATa" that you are refering to. Could you me give a reference regarding the sequence of the primers and probes you've used for the quantitative PCR. Thank you very much.
|
|||||||||
ANSWER: |
Thank you for your enquiry. This antibody was tested for its capacity to immunoprecipitate chromatin here at Abcam. Our laboratory team were responsible for the design and execution of the experiments. I have been in touch with them and the definitions and primer sequences for the SAT regions are as follows. "SAT2" - Accession number X72623 Chr1 hSat2 repeat - F ATCGAATGGAAATGAAAGGAGTCA Chr1 hSat2 repeat - R GACCATTGGATGATTGCAGTCA "SATa" - Accession number M26919 Chr1 hSat alpha - F AAGGTCAATGGCAGAAAAGAA Chr1 hSat alpha - R CAACGAAGGCCACAAGATGTC I hope that this information helps. Please do not hesitate to contact me should you require further assistance. |
||||||||
|
|||||||||
BATCH NUMBER 74959 ORDER NUMBER 61329 DESCRIPTION OF THE PROBLEM No signal at all SAMPLE mouse cultured cells PRIMARY ANTIBODY ab12405 1:100 SECONDARY ANTIBODY donkey anti mouse Cy3 (Jackson Lab) DETECTION METHOD Immunofluorescent microscopy POSITIVE AND NEGATIVE CONTROLS USED negative control: normal mouse IgG instead of ab12405 No positive control (the staining with ab8898 in the same experiment worked) ANTIBODY STORAGE CONDITIONS 4 degree (centigrade) FIXATION OF SAMPLE 4% PFA for 10 min ANTIGEN RETRIEVAL none PERMEABILIZATION STEP 0.1% Triton in preblocking buffer BLOCKING CONDITIONS 0.3% donkey serum in TBS+0.1% Triton X100 HOW MANY TIMES HAVE YOU TRIED THE APPLICATION? 2 HAVE YOU RUN A "NO PRIMARY" CONTROL? Yes DO YOU OBTAIN THE SAME RESULTS EVERY TIME? Yes WHAT STEPS HAVE YOU ALTERED? use 1:100 dilution of ab12405 instead of 1:500 dilution ADDITIONAL NOTES We routinely doing staining on cells. This ab12405 did not work at all in all our staining,while other antibodies worked in the same experiments. ab12405 also did not work for western blotting.
|
|||||||||
ANSWER: |
I would like to recommend trying a fixation with ice cold methanol or acetone for 10min and adding triton x100 (0.1%) in the dilution buffer of both primary and secondary antibodies. If you still have problems with this antibody in ICC and WB please let me know and I will arrange for a replacement antibody to be sent to you, |
||||||||
|
|||||||||
BATCH NUMBER 74959 ORDER NUMBER 61329 DESCRIPTION OF THE PROBLEM no bands at all SAMPLE mouse, cultured cell extract and total brain lysate PRIMARY ANTIBODY ab12405 1:300 in TBST+ 1% BSA SECONDARY ANTIBODY anti-Mouse HRP (Perkin Elmer) DETECTION METHOD ECLplus POSITIVE AND NEGATIVE CONTROLS USED none ANTIBODY STORAGE CONDITIONS 4 degree (centigrade) SAMPLE PREPARATION RIPA buffer 20mM Tris, pH 8, 150mM NaCL. 1% Triton x100, 1mM DTT, freshed added 1 tablet/10ml protease inhibitor cocktail (Roche) AMOUNT OF PROTEIN LOADED 50 ug ELECTROPHORESIS/GEL CONDITIONS Tris-Glycine getl 15%, loading dye has b-ME for reduction TRANSFER AND BLOCKING CONDITIONS Standard Tris-Glycine 10% Methanol transfer buffer Blcok with 5% non-fat milk in TBST HOW MANY TIMES HAVE YOU TRIED THE APPLICATION? 3 HAVE YOU RUN A "NO PRIMARY" CONTROL? No DO YOU OBTAIN THE SAME RESULTS EVERY TIME? Yes WHAT STEPS HAVE YOU ALTERED? increase protein loaded from 30 ug to 50 ug ADDITIONAL NOTES I made correction of lot number here I did western blot with ab8898 at the same time and it worked but ab 12405 did not work ab12405 also did not work for immuno staining
|
|||||||||
ANSWER: |
I'm sorry to hear you are having problems with ab12405 both in WB and in IHC. For the WB problem, I would like to suggest using a nuclear extract of your cells rather than a whole cell extract as the protein is nuclear. You did not mention the incubation time with the primary antibody, please make sure you incubate overnight at 4C. We have a protocol for histone western blotting that you may want to take a look at, I enclose it here: is protocol refers to western blot detection of Histone proteins derived from purified calf thymus. Please note that protein loadings derived from cellular lysates will need to be determined empirically. For each gel lane between 1-2 mg of total Histone protein solution in 1x sample buffer should prove sufficient. The choice of sample buffer will vary depending on the type of gel used (i.e. Tris / glycine or Tris / Tricine SDS PAGE). N.B. A higher percentage gel such as 10-20% Tricine SDS-polyacrylamide is recommended for effective resolution of Histone proteins The sample should be supplemented with 5% (v/v) b-mercaptoethanol and heated to around 95°C for 5 min. The sample should be centrifuged briefly to restore sample volume from condensation formation in the eppendorf during heating. Load the protein samples onto the appropriate SDS-polyacrylamide gel and run the gel under standard conditions. NB it is advisable not to run the dye front completely off the gel when dealing with smaller protein resolutions. For protein transfer from the gel please refer to the protocols supplied with your transfer apparatus, as these will vary depending upon the method of transfer employed i.e. semi-dry blotting or wet blotting. N.B. Nitrocellulose membranes with a pore size of 0.2 mm are recommended for optimal retention of Histone proteins. Transfer times between 30 min and 90 min should prove sufficient for effective protein transfer. Visualise equivalent protein loadings using Ponceau staining Block the membranes by adding an appreciable volume of blocking buffer (5% (w/v) BSA, 0.5% (v/v) Tween-20 in TBS or PBS as preferred). Incubate for 1 h at room temperature by gentle rotation. Dilute the primary antibody in blocking buffer as suggested in the datasheet protocols and incubate the blots overnight at 4°C with gentle rotation. N.B. If you wish to perform blocking peptide studies then a final concentration of between 0.1 and 1.0 mg/ml peptide should be pre-incubated with the antibody for around 20 min at room temperature before the blots are added. Rinse the blots briefly in PBS or TBS then perform two 5 min washes in blocking buffer. Prepare the relevant secondary antibody conjugate in blocking buffer and incubate the blots for 1 h at room temperature with gentle rotation. Wash the blots with three 5 min washes in blocking buffer and then perform a final rinse in PBS or TBS. Perform ECL, ECF or infrared detection as described by the manufacturer. Top Tips for Successful Western blotting with our range of Histone antibodies. · Use a high percentage gel for clear resolution of Histone proteins. · Use nitrocellulose membrane with a pore size of 0.2 mm to ensure optimal capture of Histone proteins. · Use high quality BSA in your blocking solutions rather than conventional dried milk such as Marvel. We also recommend HeLa nuclear extract as a positive control, you may wish to try this in parallel. If you still have a problem do not hesitate to contact us again, |
||||||||
|
|||||||||
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"
Chromatin was prepared from U2OS cells according to the Abcam X-ChIP protocol. Cells were fixed with formaldehyde for 10 min. The ChIP was performed with 25 µg of chromatin, 8 µg of ab12405 (blue), and 20 µl of Protein A/G sepharose beads. No antibody was added to the beads control (yellow). The immunoprecipitated DNA was quantified by real time PCR (Taqman approach for active and inactive loci, Sybr green approach for heterochromatic loci). Primers and probes are located in the first kb of the transcribed region.
1
Call 01223 696 000 or contact us