Overview

  • Product name
  • Description
    Rabbit polyclonal to POLR3A
  • Tested applications
    Suitable for: WB, ChIPmore details
  • Species reactivity
    Reacts with: Mouse, Human
    Predicted to work with: Cow
  • Immunogen

    Recombinant protein fragment contain a sequence corresponding to a region within amino acids 182 and 452 of POLR3A

  • Positive control
    • HCT116 whole cell lysate

Properties

Applications

Our Abpromise guarantee covers the use of ab96328 in the following tested applications.

The application notes include recommended starting dilutions; optimal dilutions/concentrations should be determined by the end user.

Application Abreviews Notes
WB 1/500 - 1/3000. Predicted molecular weight: 156 kDa.
ChIP Use at an assay dependent concentration.

Target

  • Function
    DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Largest and catalytic core component of RNA polymerase III which synthesizes small RNAs, such as 5S rRNA and tRNAs. Forms the polymerase active center together with the second largest subunit. A single-stranded DNA template strand of the promoter is positioned within the central active site cleft of Pol III. A bridging helix emanates from RPC1 and crosses the cleft near the catalytic site and is thought to promote translocation of Pol III by acting as a ratchet that moves the RNA-DNA hybrid through the active site by switching from straight to bent conformations at each step of nucleotide addition (By similarity). Plays a key role in sensing and limiting infection by intracellular bacteria and DNA viruses. Acts as nuclear and cytosolic DNA sensor involved in innate immune response. Can sense non-self dsDNA that serves as template for transcription into dsRNA. The non-self RNA polymerase III transcripts, such as Epstein-Barr virus-encoded RNAs (EBERs) induce type I interferon and NF- Kappa-B through the RIG-I pathway.
  • Tissue specificity
    Expressed in the brain, in the cortex and the white matter (at protein level).
  • Involvement in disease
    Leukodystrophy, hypomyelinating, 7, with or without oligodontia and/or hypogonadotropic hypogonadism
  • Sequence similarities
    Belongs to the RNA polymerase beta' chain family.
  • Cellular localization
    Nucleus.
  • Information by UniProt
  • Database links
  • Alternative names
    • BC053071 antibody
    • DNA directed RNA polymerase III largest subunit antibody
    • DNA directed RNA polymerase III subunit A antibody
    • DNA-directed RNA polymerase III largest subunit antibody
    • DNA-directed RNA polymerase III subunit A antibody
    • DNA-directed RNA polymerase III subunit RPC1 antibody
    • hRPC155 antibody
    • MGC62420 antibody
    • POLR 3A antibody
    • POLR3A antibody
    • Polymerase (RNA) III (DNA directed) polypeptide A 155kDa antibody
    • Polymerase (RNA) III (DNA directed) polypeptide A antibody
    • RGD1305574 antibody
    • RNA polymerase III 155 kDa subunit antibody
    • RNA polymerase III subunit C1 antibody
    • RNA polymerase III subunit C160 antibody
    • RNA polymerase III subunit RPC155 D antibody
    • RPC1 antibody
    • RPC1_HUMAN antibody
    • RPC155 antibody
    see all

Images

  • ChIP analysis using ab96328 binding POLR3A in 3T3 fibroblast whole cell lysate. Cells were cross-linked for 10 minutes with formaldehyde. Samples were incubated with undiluted primary antibody for 12 hours at 4°C. Protein binding was detected using real-time PCR.
    Positive control: tRNA le and tRNA ser.
    Negative Control:IgG.

    See Abreview

  • Anti-POLR3A antibody (ab96328) at 1/500 dilution + HCT116 cell lysate at 30 µg

    Predicted band size : 156 kDa

References

This product has been referenced in:
  • Karijolich J  et al. Genome-wide mapping of infection-induced SINE RNAs reveals a role in selective mRNA export. Nucleic Acids Res 45:6194-6208 (2017). ChIP . Read more (PubMed: 28334904) »
  • Choquet K  et al. Absence of neurological abnormalities in mice homozygous for the Polr3a G672E hypomyelinating leukodystrophy mutation. Mol Brain 10:13 (2017). Read more (PubMed: 28407788) »

See all 4 Publications for this product

Customer reviews and Q&As

Application
ChIP
Detection step
Real-time PCR
Sample
Mouse Cell lysate - whole cell (3T3 Fibroblasts)
Specification
3T3 Fibroblasts
Negative control
IgG
Type
Cross-linking (X-ChIP)
Duration of cross-linking step: 10 minute(s) and 0 second(s)
Specification of the cross-linking agent: Formaldehyde
Positive control
tRNA leu & tRNA ser
Username

Ms. Jennifer Blancas

Verified customer

Submitted Jan 20 2014

Abcam guarantees this product to work in the species/application used in this Abreview.
Application
ChIP
Sample
Human Cell lysate - whole cell (Raji)
Specification
Raji
Type
Cross-linking (X-ChIP)
Duration of cross-linking step: 10 minute(s) and 0 second(s)
Specification of the cross-linking agent: Formaldehyde
Detection step
Real-time PCR
Positive control
Primer set for tRNA-Leu 5'-GTC AGG ATG GCC GAG TCT AAG-3' and 5'-CCA CGC CTC CAT ACG GAG AAC CAG AAG ACC C-3' from Johnson, S.S. et al Molecular Cell
Negative control
IgG and primer set for Alu on Chromosome 10 5’GATTCTCAACAGCAGAATTCCATGCC3’ and 5’CATGTTTGAGAATGTCTACTTCTTAG3’ from Zeng, W. et al 2009 PLOS Genetics
Username

Abcam user community

Verified customer

Submitted Jan 16 2012

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"

Sign up