Overview

  • Product name
    Recombinant E. coli LexA protein
  • Protein length
    Full length protein

Description

  • Nature
    Recombinant
  • Source
    Escherichia coli
  • Amino Acid Sequence
    • Accession
    • Species
      Escherichia coli
    • Sequence
      MKALTARQQE VFDLIRDHIS QTGMPPTRAE IAQRLGFRSP NAAEEHLKAL ARKGVIEIVS GASRGIRLLQ EEEEGLPLVG RVAAGEPLLA QQHIEGHYQV DPSLFKPNAD FLLRVSGMSM KDIGIMDGDL LAVHKTQDVR NGQVVVARID DEVTVKRLKK QGNKVELLPE NSEFKPIVVD LRQQSFTIEG LAVGVIRNGD WL

Specifications

Our Abpromise guarantee covers the use of ab63816 in the following tested applications.

The application notes include recommended starting dilutions; optimal dilutions/concentrations should be determined by the end user.

  • Applications

    SDS-PAGE

  • Purity
    > 90 % SDS-PAGE.
    highly purified by several steps of chromatography
  • Form
    Liquid
  • Additional notes


    This protein can be used in: 1) Studies on the mechanism of E. coli SOS response. 2) Used as an antigen for positive control in Western blotting to confirm that the Bait construct is expressed stably in the nucleus as protein of the expected size in the yeast two-hybrid method using the lexA gene.

  • Concentration information loading...

Preparation and Storage

  • Stability and Storage

    Shipped at 4°C. Upon delivery aliquot and store at -20°C. Avoid freeze / thaw cycles.

    Preservative: None
    Constituents: 50% Glycerol, 5mM Beta mercaptoethanol, 2mM EDTA, 100mM Sodium chloride, 10mM Tris HCl, pH 7.5

General Info

  • Alternative names
    • Lex A
    • LexA repressor
  • Relevance
    E. coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As the result, the expression of genes belonging to the SOS regulon is induced, and DNA repair ability and mutagenic activity in the cells are enhanced.

Images

  • SDS-PAGE analysis of Recombinant E. coli LexA protein (ab63816).

  • SDS Page analysis of ab63816

References

This product has been referenced in:
  • Bunnell BE  et al. Zinc blocks SOS-induced antibiotic resistance via inhibition of RecA in Escherichia coli. PLoS One 12:e0178303 (2017). Read more (PubMed: 28542496) »

See 1 Publication for this product

Customer reviews and Q&As

There are currently no Customer reviews or Questions for ab63816.
Please use the links above to contact us or submit feedback about this product.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"

Sign up