JavaScript is disabled in your browser. Please enable JavaScript to view this website.
AB207225

p53 Transcription Factor Assay Kit (Colorimetric)

Be the first to review this product! Submit a review

|

(5 Publications)

p53 Transcription Factor Assay Kit (Colorimetric) (ab207225) is a high throughput assay to quantify p53 activation in nuclear extracts.

View Alternative Names

P53, TP53, Cellular tumor antigen p53, Antigen NY-CO-13, Phosphoprotein p53, Tumor suppressor p53

1 Images
Functional Studies - p53 Transcription Factor Assay Kit (Colorimetric) (AB207225)
  • FuncS

Supplier Data

Functional Studies - p53 Transcription Factor Assay Kit (Colorimetric) (AB207225)

Different amounts of nuclear extracts from untreated (Gray) and H2O2-treated (Black) MCF-7 cells are tested for p53 activation by using the p53 TF Assay Kit.

Different amounts of nuclear extracts from untreated (grey) and H2O2-treated (black) MCF-7 cells were tested for p53 activation. These curves are provided for demonstration only.

Key facts

Detection method

Colorimetric

Sample types

Nuclear Extracts

Reacts with

Human

Results type

Semi-Quantitative

Sensitivity

< 600 ng/well

Assay time

3h 30m

Assay Platform

Microplate reader

Product details

p53 Transcription Factor Assay Kit (Colorimetric) (ab207225) is a high throughput assay to quantify p53 activation in nuclear extracts. This assay combines a quick ELISA format with a sensitive and specific non-radioactive assay for transcription factor activation.

A specific double stranded DNA sequence containing the p53 consensus binding site (5' – GGACATGCCCGGGCATGTCC – 3') has been immobilized onto a 96-well plate. Active p53 present in the nuclear extract specifically binds to the oligonucleotide. p53 is detected by a primary antibody that recognizes an epitope of p53 accessible only when the protein is activated and bound to its target DNA. An HRP-conjugated secondary antibody provides sensitive colorimetric readout that at OD 450 nm. This product detects only human p53.

Key performance and benefits:

  • Assay time: 3.5 hours (cell extracts preparation not included).
  • Detection limit: < 0.6 μg nuclear extract/well.
  • Detection range: 0.6 – 10 μg nuclear extract/well.

The tumor suppressor protein p53 is a transcription factor that switches on a series of protective genes when the cell is exposed to stressful events. Many solid tumors contain defective forms of p53 that are unable to stop cells from proliferating when, for example, their DNA has been damaged. Therefore, p53 functions to selectively destroy stressed or abnormal cells, thereby protecting the organism from cancer development. Stress events include radiation, low pH, heat shock, hypoxia, genotoxins, DNA damage, RNA polymerase II block and oxidant injury. Two human p53 homologues, p73 and p63 were recently identified with roles in stem cell identity, neurogenesis, natural immunity and homeostatic control. These homologues can drive gene expression from promoters similar to that bound by p53, but neither of these have been found to be highly mutated in cancers, nor is p73 bound to viral oncoproteins that neutralize p53 protein activity, so their function in regulating p53-dependent cancer progression is unclear.

p53 possesses a modular architecture with an N-terminal transactivation domain, a strongly conserved core DNA-binding domain, a tetramerization domain, and a regulatory C terminus. The p53 DNA-binding domain comprises several hot spot regions for mutation that inactivate p53 in more than half of all human tumors. Tetrameric p53 binds specifically to a DNA consensus sequence consisting of two consecutive palindromic 10-bp half-sites 5´-RRRCWWGYYY-3´ (R = A or G, Y = C or T, W = A or T), which can be separated from 0 to 13 bp. The tetramer assembly stabilizes the p53 monomer folding and increases the DNA-binding activity of p53. p53 stays inactive in the nucleus when bound to MDM2 protein, an E3 ubiquitin ligase that targets both p53 and itself for ubiquitination. MDM2 represses p53 activity by inducing its nuclear export and degradation in proteasomes. Stress signals, such as DNA damage, activate protein kinases that lead to p53 phosphorylation of numerous sites and subsequent activation of p53 by inhibiting p53-MDM2 interaction. MDM2 gene expression is regulated by p53, creating a feedback loop in which p53 activates expression of MDM2, which keeps p53 levels low during normal growth and development.

What's included?

{ "values": { "5x96Tests": { "sellingSize": "5 x 96 Tests", "publicAssetCode":"ab207225-5x96Tests", "assetComponentDetails": [ { "size":"5 x 2.2 mL", "name":"10X Antibody Binding Buffer", "number":"AB207225-CMP01" }, { "size":"5 x 22 mL", "name":"10X Wash Buffer", "number":"AB207225-CMP02" }, { "size":"5 x 10 mL", "name":"Lysis Buffer", "number":"AB207225-CMP04" }, { "size":"5 x 40 µL", "name":"MCF-7 (H2O2) nuclear extract (2.5 mg/mL)", "number":"AB207225-CMP05" }, { "size":"5 x 100 µL", "name":"Mutated oligonucleotide (10 pmol/μL)", "number":"AB207225-CMP06" }, { "size":"5 x 11 µL", "name":"Anti-rabbit HRP-conjugated IgG", "number":"AB207225-CMP07" }, { "size":"5 x 10 mL", "name":"Binding Buffer", "number":"AB207225-CMP08" }, { "size":"5 x 11 mL", "name":"Developing Solution", "number":"AB207225-CMP09" }, { "size":"5 x 100 µL", "name":"Dithiothreitol (DTT) (1 M)", "number":"AB207225-CMP10" }, { "size":"5 x 11 µL", "name":"p53 antibody (0.2 mg/mL)", "number":"AB207225-CMP11" }, { "size":"5 x 100 µL", "name":"Poly [d(l-c)] (17 µg/μL)", "number":"AB207225-CMP13" }, { "size":"5 x 100 µL", "name":"Protease Inhibitor Cocktail", "number":"AB207225-CMP14" }, { "size":"5 x 11 mL", "name":"Stop Solution", "number":"AB207225-CMP15" }, { "size":"5 x 100 µL", "name":"Wild-type oligonucleotide (10 pmol/μL)", "number":"AB207225-CMP16" }, { "size":"5 x 1 Unit", "name":"96-well p53 assay plate", "number":"AB207225-CMP03" }, { "size":"5 x 1 Unit", "name":"Plate sealer", "number":"AB207225-CMP12" } ] }, "1x96Tests": { "sellingSize": "1 x 96 Tests", "publicAssetCode":"ab207225-1x96Tests", "assetComponentDetails": [ { "size":"1 x 100 µL", "name":"Wild-type oligonucleotide (10 pmol/μL)", "number":"AB207225-CMP16", "productcode":"" }, { "size":"1 x 1 Unit", "name":"96-well p53 assay plate", "number":"AB207225-CMP03", "productcode":"" }, { "size":"1 x 1 Unit", "name":"Plate sealer", "number":"AB207225-CMP12", "productcode":"" }, { "size":"1 x 100 µL", "name":"Mutated oligonucleotide (10 pmol/μL)", "number":"AB207225-CMP06", "productcode":"" }, { "size":"1 x 100 µL", "name":"Dithiothreitol (DTT) (1 M)", "number":"AB207225-CMP10", "productcode":"" }, { "size":"1 x 11 mL", "name":"Stop Solution", "number":"AB207225-CMP15", "productcode":"" }, { "size":"1 x 10 mL", "name":"Binding Buffer", "number":"AB207225-CMP08", "productcode":"" }, { "size":"1 x 11 µL", "name":"Anti-rabbit HRP-conjugated IgG", "number":"AB207225-CMP07", "productcode":"" }, { "size":"1 x 2.2 mL", "name":"10X Antibody Binding Buffer", "number":"AB207225-CMP01", "productcode":"" }, { "size":"1 x 10 mL", "name":"Lysis Buffer", "number":"AB207225-CMP04", "productcode":"" }, { "size":"1 x 11 mL", "name":"Developing Solution", "number":"AB207225-CMP09", "productcode":"" }, { "size":"1 x 11 µL", "name":"p53 antibody (0.2 mg/mL)", "number":"AB207225-CMP11", "productcode":"" }, { "size":"1 x 100 µL", "name":"Protease Inhibitor Cocktail", "number":"AB207225-CMP14", "productcode":"" }, { "size":"1 x 100 µL", "name":"Poly [d(l-c)] (17 µg/μL)", "number":"AB207225-CMP13", "productcode":"" }, { "size":"1 x 40 µL", "name":"MCF-7 (H2O2) nuclear extract (2.5 mg/mL)", "number":"AB207225-CMP05", "productcode":"" }, { "size":"1 x 22 mL", "name":"10X Wash Buffer", "number":"AB207225-CMP02", "productcode":"" } ] } } }

Properties and storage information

Shipped at conditions
Dry Ice
Appropriate short-term storage conditions
Multi
Appropriate long-term storage conditions
Multi
Storage information
Please refer to protocols

Supplementary information

This supplementary information is collated from multiple sources and compiled automatically.

The protein p53 also known as TP53 or tumor protein p53 has a molecular weight of approximately 53 kDa. It acts as a transcription factor and plays a major role in cell cycle regulation apoptosis and maintaining genomic stability. This protein mainly expresses in the nucleus of cells and acts as a critical regulator of cellular responses to stress signals including DNA damage. Scientists commonly use p53 antibodies in various assays like western blot and p53 immunofluorescence to detect and study its expression and functional status in cells.
Biological function summary

P53 functions to control cell division and apoptosis serving as a guardian of the genome by preventing mutation accumulation. It does not form part of a larger complex under normal conditions but interacts with various other molecules to execute its functions. p53 can activate or suppress the transcription of numerous genes involved in cell cycle arrest DNA repair and programmed cell death allowing it to halt the progression of damaged cells and trigger repair mechanisms or eliminate those that cannot be repaired.

Pathways

P53 acts within several key biological pathways such as the p53 signaling pathway and the intrinsic apoptotic pathway. Its activity involves interaction with proteins like MDM2 which regulates p53 through ubiquitin-mediated degradation and ATM kinase which phosphorylates p53 in response to DNA damage. These interactions ensure appropriate cellular responses during stress and are vital for maintaining homeostasis.

P53 mutation or inactivation is often associated with the development of cancer given its role in controlling cell division and preventing tumor formation. Specifically its dysfunction has been linked to cancers such as breast cancer and lung cancer. Additionally p53 can interact with other mutant proteins like Ras compounding mutations that contribute to tumor progression and aggressive cancer phenotypes. Understanding these interactions and the status of p53 can be important in developing targeted cancer therapies.

Product protocols

Target data

Multifunctional transcription factor that induces cell cycle arrest, DNA repair or apoptosis upon binding to its target DNA sequence (PubMed : 11025664, PubMed : 12524540, PubMed : 12810724, PubMed : 15186775, PubMed : 15340061, PubMed : 17317671, PubMed : 17349958, PubMed : 19556538, PubMed : 20673990, PubMed : 20959462, PubMed : 22726440, PubMed : 24051492, PubMed : 24652652, PubMed : 35618207, PubMed : 36634798, PubMed : 38653238, PubMed : 9840937). Acts as a tumor suppressor in many tumor types; induces growth arrest or apoptosis depending on the physiological circumstances and cell type (PubMed : 11025664, PubMed : 12524540, PubMed : 12810724, PubMed : 15186775, PubMed : 15340061, PubMed : 17189187, PubMed : 17317671, PubMed : 17349958, PubMed : 19556538, PubMed : 20673990, PubMed : 20959462, PubMed : 22726440, PubMed : 24051492, PubMed : 24652652, PubMed : 38653238, PubMed : 9840937). Negatively regulates cell division by controlling expression of a set of genes required for this process (PubMed : 11025664, PubMed : 12524540, PubMed : 12810724, PubMed : 15186775, PubMed : 15340061, PubMed : 17317671, PubMed : 17349958, PubMed : 19556538, PubMed : 20673990, PubMed : 20959462, PubMed : 22726440, PubMed : 24051492, PubMed : 24652652, PubMed : 9840937). One of the activated genes is an inhibitor of cyclin-dependent kinases. Apoptosis induction seems to be mediated either by stimulation of BAX and FAS antigen expression, or by repression of Bcl-2 expression (PubMed : 12524540, PubMed : 17189187). Its pro-apoptotic activity is activated via its interaction with PPP1R13B/ASPP1 or TP53BP2/ASPP2 (PubMed : 12524540). However, this activity is inhibited when the interaction with PPP1R13B/ASPP1 or TP53BP2/ASPP2 is displaced by PPP1R13L/iASPP (PubMed : 12524540). In cooperation with mitochondrial PPIF is involved in activating oxidative stress-induced necrosis; the function is largely independent of transcription. Induces the transcription of long intergenic non-coding RNA p21 (lincRNA-p21) and lincRNA-Mkln1. LincRNA-p21 participates in TP53-dependent transcriptional repression leading to apoptosis and seems to have an effect on cell-cycle regulation. Implicated in Notch signaling cross-over. Prevents CDK7 kinase activity when associated to CAK complex in response to DNA damage, thus stopping cell cycle progression. Isoform 2 enhances the transactivation activity of isoform 1 from some but not all TP53-inducible promoters. Isoform 4 suppresses transactivation activity and impairs growth suppression mediated by isoform 1. Isoform 7 inhibits isoform 1-mediated apoptosis. Regulates the circadian clock by repressing CLOCK-BMAL1-mediated transcriptional activation of PER2 (PubMed : 24051492).
See full target information TP53

Publications (5)

Recent publications for all applications. Explore the full list and refine your search

Cancer cell international 23:49 PubMed36932402

2023

Changes in calpain-2 expression during glioblastoma progression predisposes tumor cells to temozolomide resistance by minimizing DNA damage and p53-dependent apoptosis.

Applications

Unspecified application

Species

Unspecified reactive species

Maren Nicole Stillger,Chia-Yi Chen,Zon Weng Lai,Mujia Li,Agnes Schäfer,Axel Pagenstecher,Christopher Nimsky,Jörg Walter Bartsch,Oliver Schilling

Nanomaterials (Basel, Switzerland) 13: PubMed36903823

2023

An Analysis of the Toxicity, Antioxidant, and Anti-Cancer Activity of Cinnamon Silver Nanoparticles in Comparison with Extracts and Fractions of Cinnamomum Cassia at Normal and Cancer Cell Levels.

Applications

Unspecified application

Species

Unspecified reactive species

Y G El-Baz,A Moustafa,M A Ali,G E El-Desoky,S M Wabaidur,M M Faisal

Oncology reports 48: PubMed35856441

2022

Administration of 4‑hexylresorcinol increases p53‑mediated transcriptional activity in oral cancer cells with the p53 mutation.

Applications

Unspecified application

Species

Unspecified reactive species

Yei-Jin Kang,Won-Geun Yang,Weon-Sik Chae,Dae-Won Kim,Seong-Gon Kim,Horatiu Rotaru

Molecules (Basel, Switzerland) 26: PubMed34770781

2021

Nano Milk Protein-Mucilage Complexes: Characterization and Anticancer Effect.

Applications

Unspecified application

Species

Unspecified reactive species

Ahmed Ali Abd El-Maksoud,Amal I A Makhlouf,Ammar B Altemimi,Ismail H Abd El-Ghany,Amr Nassrallah,Francesco Cacciola,Tarek Gamal Abedelmaksoud

Oncogene 39:4028-4044 PubMed32205867

2020

Hypoxia-induced release, nuclear translocation, and signaling activity of a DLK1 intracellular fragment in glioma.

Applications

Unspecified application

Species

Unspecified reactive species

Elisa Stellaria Grassi,Vasiliki Pantazopoulou,Alexander Pietras
View all publications
websiteProtocolBooklet
en

Product promise

We are committed to supporting your work with high-quality reagents, and we're here for you every step of the way. In the unlikely event that one of our products does not perform as expected, you're protected by our Product Promise.
For full details, please see our Terms & Conditions

Please note: All products are 'FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC OR THERAPEUTIC PROCEDURES'.

For licensing inquiries, please contact partnerships@abcam.com