p53 Transcription Factor Assay Kit (Colorimetric)

Product details

p53 Transcription Factor Assay Kit (Colorimetric) (ab207225) is a high throughput assay to quantify p53 activation in nuclear extracts. This assay combines a quick ELISA format with a sensitive and specific non-radioactive assay for transcription factor activation.

A specific double stranded DNA sequence containing the p53 consensus binding site (5' – GGACATGCCCGGGCATGTCC – 3') has been immobilized onto a 96-well plate. Active p53 present in the nuclear extract specifically binds to the oligonucleotide. p53 is detected by a primary antibody that recognizes an epitope of p53 accessible only when the protein is activated and bound to its target DNA. An HRP-conjugated secondary antibody provides sensitive colorimetric readout that at OD 450 nm. This product detects only human p53.

Key performance and benefits:

• Assay time: 3.5 hours (cell extracts preparation not included).
• Detection limit: < 0.6 μg nuclear extract/well.
• Detection range: 0.6 – 10 μg nuclear extract/well.

The tumor suppressor protein p53 is a transcription factor that switches on a series of protective genes when the cell is exposed to stressful events. Many solid tumors contain defective forms of p53 that are unable to stop cells from proliferating when, for example, their DNA has been damaged. Therefore, p53 functions to selectively destroy stressed or abnormal cells, thereby protecting the organism from cancer development. Stress events include radiation, low pH, heat shock, hypoxia, genotoxins, DNA damage, RNA polymerase II block and oxidant injury. Two human p53 homologues, p73 and p63 were recently identified with roles in stem cell identity, neurogenesis, natural immunity and homeostatic control. These homologues can drive gene expression from promoters similar to that bound by p53, but neither of these have been found to be highly mutated in cancers, nor is p73 bound to viral oncoproteins that neutralize p53 protein activity, so their function in regulating p53-dependent cancer progression is unclear.

p53 possesses a modular architecture with an N-terminal transactivation domain, a strongly conserved core DNA-binding domain, a tetramerization domain, and a regulatory C terminus. The p53 DNA-binding domain comprises several hot spot regions for mutation that inactivate p53 in more than half of all human tumors. Tetrameric p53 binds specifically to a DNA consensus sequence consisting of two consecutive palindromic 10-bp half-sites 5´-RRRCWWGYYY-3´ (R = A or G, Y = C or T, W = A or T), which can be separated from 0 to 13 bp. The tetramer assembly stabilizes the p53 monomer folding and increases the DNA-binding activity of p53. p53 stays inactive in the nucleus when bound to MDM2 protein, an E3 ubiquitin ligase that targets both p53 and itself for ubiquitination. MDM2 represses p53 activity by inducing its nuclear export and degradation in proteasomes. Stress signals, such as DNA damage, activate protein kinases that lead to p53 phosphorylation of numerous sites and subsequent activation of p53 by inhibiting p53-MDM2 interaction. MDM2 gene expression is regulated by p53, creating a feedback loop in which p53 activates expression of MDM2, which keeps p53 levels low during normal growth and development.