Rat Monoclonal 5-hydroxymethylcytosine (5-hmC) antibody. Suitable for Dot, IP, IHC-Fr, ChIP, ICC/IF, MeDIP and reacts with Nucleic Acid samples. Cited in 23 publications. Immunogen corresponding to Chemical / Small Molecule corresponding to 5-Hydroxymethylcytosine.
IgG2a
Rat
Preservative: 0.02% Sodium azide
Constituents: 99.98% PBS
Liquid
Monoclonal
Dot | IP | IHC-Fr | ChIP | ICC/IF | MeDIP | |
---|---|---|---|---|---|---|
Nucleic Acid | Tested | Expected | Expected | Tested | Expected | Tested |
Species | Dilution info | Notes |
---|---|---|
Species Nucleic Acid | Dilution info 1/500 | Notes - |
Species | Dilution info | Notes |
---|---|---|
Species Nucleic Acid | Dilution info 1/200 | Notes - |
Species | Dilution info | Notes |
---|---|---|
Species Nucleic Acid | Dilution info 1/500.00000 - 1/1000.00000 | Notes - |
Species | Dilution info | Notes |
---|---|---|
Species Nucleic Acid | Dilution info - | Notes - |
Species | Dilution info | Notes |
---|---|---|
Species Nucleic Acid | Dilution info 1/500.00000 - 1/1000.00000 | Notes - |
Species | Dilution info | Notes |
---|---|---|
Species Nucleic Acid | Dilution info - | Notes - |
Select an associated product type
5-hmC
Rat Monoclonal 5-hydroxymethylcytosine (5-hmC) antibody. Suitable for Dot, IP, IHC-Fr, ChIP, ICC/IF, MeDIP and reacts with Nucleic Acid samples. Cited in 23 publications. Immunogen corresponding to Chemical / Small Molecule corresponding to 5-Hydroxymethylcytosine.
IgG2a
Rat
Preservative: 0.02% Sodium azide
Constituents: 99.98% PBS
Liquid
Monoclonal
AB3/63.3
Affinity purification Protein G
Some reports suggest that this antibody will detect 5hmC in double stranded DNA, although this has not been reliably confirmed. The target epitope is partially obstructed by base-pairing, so the antibody will have a stronger affinity if the DNA is single stranded or depurinated.
Blue Ice
1-2 weeks
+4°C
-20°C
Upon delivery aliquot
Avoid freeze / thaw cycle
Abcam is leading the way to address reproducibility in scientific research with our highly validated recombinant monoclonal and recombinant multiclonal antibodies. Search & select one of Abcam's thousands of recombinant alternatives to eliminate batch-variability and unnecessary animal use.
If you do not find a host species to meet your needs, our catalogue and custom Chimeric range provides scientists the specificity of Abcam's RabMAbs in the species backbone of your choice. Remember to also review our range of edited cell lines, proteins and biochemicals relevant to your target that may help you further your research goals.
Abcam antibodies are extensively validated in a wide range of species and applications, so please check the reagent specifications meet your scientific needs before purchasing. If you have any questions or bespoke requirements, simply visit the Contact Us page to send us an inquiry or contact our Support Team ahead of purchase.
This supplementary information is collated from multiple sources and compiled automatically.
5-hydroxymethylcytosine (5-hmC) also known as hydroxymethylcytosine represents a significant epigenetic modification in DNA. This target with a mass of approximately 63.3 emerges through DNA demethylation processes where ten-eleven translocation (TET) enzymes oxidize 5-methylcytosine (5-mC). It is found largely in the brain where it shows high levels of expression but it can also appear in other tissues to a lesser extent. The modification is important in regulating gene expression and maintaining cellular identity.
5-hydroxymethylcytosine plays a critical role in epigenetic regulation and serves as an intermediary in the active DNA demethylation process. It is not part of a stable complex but interacts transiently during epigenetic reconfiguration. The presence of 5-hmC marks regulatory regions of genes and is involved in transcriptional activation or repression depending on the cellular context. Its levels are dynamic influenced by various developmental stages and environmental conditions.
This DNA modification is an important player in pathways related to cellular differentiation and development. It is integrally involved in the DNA demethylation pathway where TET enzymes mediate its formation from 5-methylcytosine. This pathway also involves other modifications leading to cytosine turnover linking 5-hmC to broader chromatin remodeling processes. Proteins interacting with 5-hmC include TET enzymes and other DNA maintenance proteins which highlight its role in maintaining genomic stability.
Aberrant 5-hmC levels show connection to several pathological states including cancer and neurological disorders. Altered hydroxymethylation patterns often associate with tumorigenesis particularly in gliomas where the misregulation of 5-hmC accompanies cancer progression. Neurological disorders like Rett syndrome also exhibit altered levels of 5-hmC implicating its role in neurodevelopmental processes. In these diseases mutations in proteins such as TET enzymes link to disrupted 5-hmC levels indicating its critical involvement in both oncogenesis and neurodevelopmental regulation.
We have tested this species and application combination and it works. It is covered by our product promise.
We have not tested this specific species and application combination in-house, but expect it will work. It is covered by our product promise.
This species and application combination has not been tested, but we predict it will work based on strong homology. However, this combination is not covered by our product promise.
We do not recommend this combination. It is not covered by our product promise.
We are dedicated to supporting your work with high quality reagents and we are here for you every step of the way should you need us.
In the unlikely event of one of our products not working as expected, you are covered by our product promise.
Full details and terms and conditions can be found here:
Terms & Conditions.
Dot blot assay shows that ab106918 specifically recognized 5-hydroxymethyl Cytidine (hmC). Indicated amounts of hmC, methyl Cytidine (mC) and Cytidine (C) were spotted onto a membrane that was then incubated with ab106918.
hmC, mC and C were generated in the following way:
M13mp18 DNA had been amplified using primers F and R;
F: atttccatgagcgtttttcc
R: gcaaggcaaagaattagcaa.
A 200 uM dNTP end concentration was used with
1. A,G,C,T and
2. A,G,hmC,T; where C had been replaced with HmdCTP.
DNA was in vitro methylated with SssI and SAM, and 2ul of pmol of each base was denatured at 95C for 5 min and spotted and dried onto the membrane.
The dot blot membrane was blocked with 10%skimmed milk + 1%BSA blocking overnight and then incubated with ab106918 at 1:500 in blocking solution. A goat anti rat HRP secondary antibody was used for ECL detection.
This image is from an anonymous collaborator.
Dot blot competition assay in which ab106918 was preincubated with 5-hydroxymethyl Cytidine (5hmC) at amounts indicated in figure. Specified amounts of 5hmC, methyl Cytidine (mC) and Cytidine (C) were spotted onto membranes and were then incubated with ab106918 that had been preincubated with 5hmC as shown in figure. ab106918 specifically recognized 5hmC and this was blocked by preincubation with 5hmC at 5 pmol/ug ab106918 (Ab).
This image is from an anonymous collaborator.
ChIP analysis of mouse ES nuclear cell lysate using ab106918 to bind 5-hydroxymethyl Cytidine. Chromatin was obtained by incubating with primary antibody (0.5 μg/μg chromatin in a glycerol IP buffer) for 16 hours at 4°C. Protein binding was detected using real-time PCR.
The specificity of ab106918 was confirmed by (h)MeDIP using qPCR validation of regions in ES cells that are highly enriched in 5-hydroxymethyl Cytidine (5hmC) (Pic1, Pic3 and Pic7) or not (Pic5 and Pic10). This image is from an anonymous collaborator.
Please note: All products are 'FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC OR THERAPEUTIC PROCEDURES'.
For licensing inquiries, please contact partnerships@abcam.com