
FirePlex® miRNA Panel – Neurology V2 (ab218371)
Key features and details
- Assay type: Multiplex
- Detection method: Flow cytometry-fluorescent
- Platform: Multiplex
- Assay time: 4 hr
Overview
-
Product name
FirePlex® miRNA Panel – Neurology V2 -
Detection method
Flow cytometry-fluorescent -
Assay type
Multiplex -
Assay time
4h 00m -
Species reactivity
Reacts with: Mouse, Rat, Human -
Product overview
Multiplex miRNA Assay - Neurology Panel (ab218371) are the FirePlex® particles designed to profile up to 65 literature curated miRNA for neurology studies, miRNAs differentially regulated in normal and abnormal neurological or psychiatric health.
NOTE: FirePlex miRNA panels require the purchase of a Run Buffer. Use our FirePlex Cytometer Setup Kit V2 (ab245835) to select the most appropriate Run Buffer for your flow cytometer.
Our multiplex miRNA assays use our FirePlex® particle technology to profile up to 65 miRNAs per well. With the same sensitivity as PCR, they can be used either directly with 10 µL of biofluids such as serum or plasma with no need for RNA purification; or with 100 pg of purified RNA.
Find a full list of validated sample types, and learn more about the performance and requirements of these assays, here.
These miRNAs have been chosen based on a detailed study of data in peer-reviewed journals and exhibit differential regulation in whole blood, plasma, serum, peripheral blood mononuclear cells (PBMCs) or isolated exosomes.
Included in the panel are general markers for multiple neurology-related diseases, markers specific to specific nervous system diseases and CNS cancers, markers that may indicate hemolysis contamination in isolated plasma/serum/exosomes and internal controls to validate assay performance.
It is important to use the normalization procedure in the FirePlex® Analysis Workbench Software to identify the miRNAs that can optimally be used for normalization with your samples. Three miRNAs that are likely to be stably expressed in biofluid samples and may be suitable have been included in this panel.
-
Notes
To use this product researchers must also purchase the appropriate Core Reagent Kit, either ab218365 for use with purified RNA or ab218342 for use with biofluids.
FirePlex® is a registered trade mark in the United States and is an unregistered trade mark elsewhere.
** Hu = Human, Ms = Mouse, Rt = Rat, Ath = Arabidopsis thaliana, Oan = Ornithorhynchus anatinus, Cel = Caenorhabditis elegans.
# miRNA 21 name miRNA Sequence (miRBase V21) Sequence homology ** MIMAT ID 1 hsa-let-7b-5p ugagguaguagguugugugguu Hu, Ms, Rt MIMAT0000063 2 hsa-let-7d-5p agagguaguagguugcauaguu Hu, Ms, Rt MIMAT0000065 3 hsa-let-7f-5p ugagguaguagauuguauaguu Hu, Ms, Rt MIMAT0000067 4 hsa-let-7g-5p ugagguaguaguuuguacaguu Hu, Ms, Rt MIMAT0000414 5 hsa-let-7i-5p ugagguaguaguuugugcuguu Hu, Ms, Rt MIMAT0000415 6 ath-mir167d ugaagcugccagcaugaucugg Ath MIMAT0000905 7 hsa-miR-103a-3p agcagcauuguacagggcuauga Hu, Ms, Rt MIMAT0000101 8 hsa-miR-107 agcagcauuguacagggcuauca Hu, Ms, Rt MIMAT0000104 9 hsa-miR-124-3p uaaggcacgcggugaaugcc Hu, Ms, Rt MIMAT0000422 10 hsa-miR-125b-5p ucccugagacccuaacuuguga Hu, Ms, Rt MIMAT0000423 11 hsa-miR-128-3p ucacagugaaccggucucuuu Hu, Ms, Rt MIMAT0000424 12 hsa-miR-1285-5p gaucucacuuuguugcccagg Hu MIMAT0022719 13 hsa-miR-132-3p uaacagucuacagccauggucg Hu, Ms, Rt MIMAT0000426 14 hsa-miR-134-5p ugugacugguugaccagagggg Hu, Ms, Rt MIMAT0000447 15 hsa-miR-142-3p uguaguguuuccuacuuuaugga Hu, Ms, Rt MIMAT0000434 16 hsa-miR-145-5p guccaguuuucccaggaaucccu Hu, Ms, Rt MIMAT0000437 17 hsa-miR-146a-5p ugagaacugaauuccauggguu Hu, Ms, Rt MIMAT0000449 18 hsa-miR-150-5p ucucccaacccuuguaccagug Hu, Ms, Rt MIMAT0000451 19 hsa-miR-151a-3p cuagacugaagcuccuugagg Hu MIMAT0000757 20 hsa-miR-155-5p uuaaugcuaaucgugauaggggu Hu MIMAT0000646 21 hsa-miR-15a-5p uagcagcacauaaugguuugug Hu, Ms MIMAT0000068 22 hsa-miR-15b-3p cgaaucauuauuugcugcucua Hu, Ms, Rt MIMAT0004586 23 hsa-miR-15b-5p uagcagcacaucaugguuuaca Hu, Ms, Rt MIMAT0000417 24 hsa-miR-16-2-3p ccaauauuacugugcugcuuua Hu MIMAT0004518 25 hsa-miR-16-5p uagcagcacguaaauauuggcg Hu, Ms, Rt MIMAT0000069 26 hsa-miR-17-5p caaagugcuuacagugcagguag Hu, Ms, Rt MIMAT0000070 27 hsa-miR-181b-5p aacauucauugcugucggugggu Hu, Ms, Rt MIMAT0000257 28 cel-mir-70-3p uaauacgucguugguguuuccau Cel MIMAT0000042 29 hsa-miR-191-5p caacggaaucccaaaagcagcug Hu, Ms, Rt MIMAT0000440 30 hsa-miR-195-5p uagcagcacagaaauauuggc Hu, Ms, Rt MIMAT0000461 31 hsa-miR-197-3p uucaccaccuucuccacccagc Hu MIMAT0000227 32 hsa-miR-206 uggaauguaaggaagugugugg Hu, Ms, Rt MIMAT0000462 33 hsa-miR-20a-5p uaaagugcuuauagugcagguag Hu, Ms, Rt MIMAT0000075 34 hsa-miR-210-3p cugugcgugugacagcggcuga Hu, Ms, Rt MIMAT0000267 35 hsa-miR-214-3p acagcaggcacagacaggcagu Hu, Ms MIMAT0000271 36 hsa-miR-21-5p uagcuuaucagacugauguuga Hu, Ms, Rt MIMAT0000076 37 hsa-miR-22-3p aagcugccaguugaagaacugu Hu, Ms, Rt MIMAT0000077 38 hsa-miR-23a-3p aucacauugccagggauuucc Hu, Ms, Rt MIMAT0000078 39 hsa-miR-24-3p uggcucaguucagcaggaacag Hu, Ms, Rt MIMAT0000080 40 hsa-miR-26b-5p uucaaguaauucaggauaggu Hu, Ms, Rt MIMAT0000083 41 hsa-miR-29b-3p uagcaccauuugaaaucaguguu Hu, Ms, Rt MIMAT0000100 42 hsa-miR-301a-3p cagugcaauaguauugucaaagc Hu, Ms, Rt MIMAT0000688 43 hsa-miR-30e-5p uguaaacauccuugacuggaag Hu, Ms, Rt MIMAT0000692 44 hsa-miR-323a-3p cacauuacacggucgaccucu Hu, Ms, Rt MIMAT0000755 45 hsa-miR-328-3p cuggcccucucugcccuuccgu Hu, Ms, Rt MIMAT0000752 46 hsa-miR-331-5p cuagguauggucccagggaucc Hu, Ms MIMAT0004700 47 hsa-miR-338-3p uccagcaucagugauuuuguug Hu, Ms MIMAT0000763 48 hsa-miR-342-3p ucucacacagaaaucgcacccgu Hu, Ms, Rt MIMAT0000753 49 hsa-miR-346 ugucugcccgcaugccugccucu Hu MIMAT0000773 50 hsa-miR-34a-5p uggcagugucuuagcugguugu Hu, Ms, Rt MIMAT0000255 51 hsa-miR-34b-3p caaucacuaacuccacugccau Hu MIMAT0004676 52 hsa-miR-34c-5p aggcaguguaguuagcugauugc Hu, Ms, Rt MIMAT0000686 53 hsa-miR-370-3p gccugcugggguggaaccuggu Hu, Ms, Rt MIMAT0000722 54 hsa-miR-382-5p gaaguuguucgugguggauucg Hu, Ms, Rt MIMAT0000737 55 hsa-miR-451a aaaccguuaccauuacugaguu Hu, Ms, Rt MIMAT0001631 56 hsa-miR-483-3p ucacuccucuccucccgucuu Hu MIMAT0002173 57 hsa-miR-486-5p uccuguacugagcugccccgag Hu, Ms, Rt MIMAT0002177 58 hsa-miR-491-5p aguggggaacccuuccaugagg Hu, Ms MIMAT0002807 59 hsa-miR-497-5p cagcagcacacugugguuugu Hu MIMAT0002820 60 hsa-miR-5010-3p uuuugugucucccauuccccag Hu MIMAT0021044 61 hsa-miR-532-5p caugccuugaguguaggaccgu Hu, Ms MIMAT0002888 62 hsa-miR-545-3p ucagcaaacauuuauugugugc Hu, Ms, Rt MIMAT0003165 63 hsa-miR-7-5p uggaagacuagugauuuuguugu Hu, Ms, Rt MIMAT0000252 64 oan-miR-7417-5p uuccccacucugagcacacagc Oan MIMAT0028982 65 hsa-miR-885-5p uccauuacacuacccugccucu Hu MIMAT0004947 66 hsa-miR-92a-1-5p agguugggaucgguugcaaugcu Hu MIMAT0004507 67 hsa-miR-93-5p caaagugcuguucgugcagguag Hu, Ms, Rt MIMAT0000093 68 hsa-miR-98-5p ugagguaguaaguuguauuguu Hu, Ms, Rt MIMAT0000096 69 x-control x-control N/A 70 blank blank N/A -
Platform
Multiplex
Properties
-
Storage instructions
Store at +4°C. Please refer to protocols. -
Components 1 x 48 tests 1 x 96 tests FirePlex® Particle Mix (Circulating) 1 x 1750µl 1 x 3500µl
Associated products
-
Related Buffer
-
Related Products
Images
-
Background-subtracted, normalized with geometric average of three samples of plasma and 3 samples of sera.
Samples of human plasma and sera were run in triplicate on the Circulating Neurology Fixed Panel using the Multiplex Circulating miRNA Assay (biofluids). Results were background subtracted and normalized using geometric average, profiling 68 miRNAs per well for each sample.
Datasheets and documents
-
SDS download
-
Datasheet download
References (1)
ab218371 has been referenced in 1 publication.
- Hoss AG et al. miR-10b-5p expression in Huntington's disease brain relates to age of onset and the extent of striatal involvement. BMC Med Genomics 8:10 (2015). PubMed: 25889241