Overview

  • Product name
    FirePlex miRNA Panel - Cardiac Toxicity
  • Detection method
    Flow cytometry-fluorescent
  • Assay type
    Multiplex
  • Assay time
    4h 00m
  • Species reactivity
    Reacts with: Rat, Dog
  • Product overview

    Multiplex miRNA Assay  - Cardiac Toxicity Panel (ab219509) are the FirePlex® particles designed to profile 28 literature curated miRNA for cardiac injury and toxicity, miRNAs (see miRNA list), selected based on peer-reviewed publications modeling drug-induced cardiac toxicity and injury. Included in this panel are miRNAs with cardiac-specific or cardiac-enriched expression, miRNAs identified as circulating biomarkers of cardiotoxicity and internal controls to validate assay performance.


    NOTE: FirePlex miRNA panels require the purchase of a Run Buffer. Use our FirePlex Cytometer Setup Kit V2 (ab245835) to select the most appropriate Run Buffer for your flow cytometer.


    Our multiplex miRNA assays use our FirePlex® particle technology with the same sensitivity as PCR, they can be used either directly with 10 µL of biofluids such as serum or plasma with no need for RNA purification; or with 100 pg of purified RNA.


    Find a full list of validated sample types, and learn more about the performance and requirements of these assays, here.


    It is important to use the normalization procedure in the FirePlex® Analysis Workbench Software to identify the miRNAs that can optimally be used for normalization with your samples. Three miRNAs that are likely to be stably expressed in biofluid samples and may be suitable have been included in this panel.

  • Notes

    To use this product researchers must also purchase the appropriate Core Reagent Kit, either ab218365 for use with purified RNA or ab218342 for use with biofluids. 

    FirePlex® is a registered trade mark in the United States and is an unregistered trade mark elsewhere. 

    ** Rno = Rattus norvegicus (rat), Cfa = Canis familiaris (dog), Ath = Arabidopsis thaliana (arabidposis), Oan = Ornithorhynchus anatinus (platypus), Cel = Caenorhabditis elegans (worm). 

    #

    miRNA 21 name

    miRNA Sequence (miRBase V21)

    MIMAT ID

    1

    rno-miR-208a-3p

    AUAAGACGAGCAAAAAGC

    MIMAT0000880

    2

    mmu-miR-208a-3p

    AUAAGACGAGCAAAAAGCUUGU

    MIMAT0000520

    3

    rno-miR-208a-5p

    GAGCUUUUGGCCCGGGUUAUAC

    MIMAT0017155

    4

    rno-miR-126a-3p

    UCGUACCGUGAGUAAUAAUGCG

    MIMAT0000832

    5

    rno-miR-6314

    AGGCACUGACAGAUCUGAUGGU

    MIMAT0025047

    6

    rno-miR-509-3p

    UGAUUGACAUGUCUGCAGUGGA

    MIMAT0024850

    7

    rno-miR-1-3p

    UGGAAUGUAAAGAAGUGUGUAU

    MIMAT0003125

    8

    rno-miR-499-5p

    UUAAGACUUGCAGUGAUGUUU

    MIMAT0003381

    9

    rno-miR-133a-3p

    UUUGGUCCCCUUCAACCAGCUG

    MIMAT0000839

    10

    rno-miR-133b-3p

    UUUGGUCCCCUUCAACCAGCUA

    MIMAT0003126

    11

    rno-mir-92a-3p

    UAUUGCACUUGUCCCGGCCUG

    MIMAT0000816

    12

    rno-miR-96

    UUUGGCACUAGCACAUUUUUGCU

    MIMAT0000818

    13

    rno-miR-129

    CUUUUUGCGGUCUGGGCUUGC

    MIMAT0000600

    14

    rno-miR-133b

    UUUGGUCCCCUUCAACCAGCUA

    MIMAT0003126

    15

    rno-miR-139

    UCUACAGUGCACGUGUCUCCAG

    MIMAT0000845

    16

    rno-mir-188-5p

    CAUCCCUUGCAUGGUGGAGGG

    MIMAT0005301

    17

    rno-miR-204

    UUCCCUUUGUCAUCCUAUGCCU

    MIMAT0000877

    18

    rno-miR-299

    UGGUUUACCGUCCCACAUACAU

    MIMAT0000901

    19

    rno-miR-337

    UUCAGCUCCUAUAUGAUGCCUUU

    MIMAT0000577

    20

    cfa-mir-371

    ACUCAAAAAAUGGCGGCACUUU

    MIMAT0007747

    21

    rno-miR-383

    CAGAUCAGAAGGUGACUGUGG

    MIMAT0003114

    22

    rno-miR-375

    UUUGUUCGUUCGGCUCGCGUGA

    MIMAT0005307

    23

    rno-miR-206-3p

    UGGAAUGUAAGGAAGUGUGUGG

    MIMAT0000879

    24

    rno-miR-16-5p

    UAGCAGCACGUAAAUAUUGGCG

    MIMAT0000785

    25

    rno-miR-192-5p

    CUGACCUAUGAAUUGACAGCC

    MIMAT0000867

    26

    rno-miR-29a

    UAGCACCAUCUGAAAUCGGUUA

    MIMAT0000802

    27

    rno-miR-186

    CAAAGAAUUCUCCUUUUGGGCU

    MIMAT0000863

    28

    rno-miR-122

    UGGAGUGUGACAAUGGUGUUUG

    MIMAT0000827

    29

    ath-mir167d

    UGAAGCUGCCAGCAUGAUCUGG

    MIMAT0000905

    30

    cel-mir-70-3p

    UAAUACGUCGUUGGUGUUUCCAU

    MIMAT0000042

    31

    oan-miR-7417-5p

    UUCCCCACUCUGAGCACACAGC

    MIMAT0028982

    32

    x-control

    x-control

     

    33

    blank

    blank

     

  • Platform
    Multiplex

Properties

  • Storage instructions
    Store at +4°C. Please refer to protocols.
  • Components 1 x 48 tests 1 x 96 tests
    FirePlex® Particle Mix (Circulating) 1 x 1750µl 1 x 3500µl

Protocols

References

ab219509 has not yet been referenced specifically in any publications.

Customer reviews and Q&As

There are currently no Customer reviews or Questions for ab219509.
Please use the links above to contact us or submit feedback about this product.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"

Sign up