Overview

  • Product name
    FirePlex miRNA Panel - Kidney Toxicity
  • Detection method
    Flow cytometry-fluorescent
  • Assay type
    Multiplex
  • Assay time
    4h 00m
  • Species reactivity
    Reacts with: Mouse, Rat, Human
  • Product overview

    Multiplex miRNA Assay  - Kidney Toxicity Panel (ab219508) are the FirePlex® particles designed to profile up to 65 literature curated miRNA for kidney injury and toxicity, miRNAs that have been demonstrated in multiple peer-reviewed studies to be differentially regulated as a part of kidney toxicity or acute kidney injury.


    NOTE: FirePlex miRNA panels require the purchase of a Run Buffer. Use our FirePlex Cytometer Setup Kit V2 (ab245835) to select the most appropriate Run Buffer for your flow cytometer.


    Our multiplex miRNA assays use our FirePlex® particle technology to profile up to 65 miRNAs per well. With the same sensitivity as PCR, they can be used either directly with 10 µL of biofluids such as serum or plasma with no need for RNA purification; or with 100 pg of purified RNA.


    Find a full list of validated sample types, and learn more about the performance and requirements of these assays, here.


    These miRNAs have been chosen based on a detailed study of data in peer-reviewed journals and exhibit differential regulation in plasma, serum, urine, isolated exosomes or total RNA from kidney or kidney-derived cell lines.


    Included in the panel are general markers for multiple kidney-related diseases, markers specific to specific kidney states or treatment responses, markers that may indicate hemolysis contamination in isolated plasma/serum/exosomes and internal controls are included to validate assay performance.


    It is important to use the normalization procedure in the FirePlex® Analysis Workbench Software to identify the miRNAs that can optimally be used for normalization with your samples. Three miRNAs that are likely to be stably expressed in biofluid samples and may be suitable have been included in this panel.

  • Notes

    To use this product researchers must also purchase the appropriate Core Reagent Kit, either ab218365 for use with purified RNA or ab218342 for use with biofluids. 

    FirePlex® is a registered trade mark in the United States and is an unregistered trade mark elsewhere. 

    ** Hsa = Homo sapiens (human), Mmu = Mus musculus (mouse), Rno = Rattus norvegicus (rat), Ath = Arabidopsis thaliana (arabidposis), Oan = Ornithorhynchus anatinus (platypus), Cel = Caenorhabditis elegans (worm). 

    #

    miRNA 21 name

    miRNA Sequence (miRBase V21)

    Sequence homology **

    MIMAT ID

    1

    hsa-let-7c-5p

    UGAGGUAGUAGGUUGUAUGGUU

    Hu, Ms, Rt

    MIMAT0000064

    2

    hsa-let-7e-5p

    UGAGGUAGGAGGUUGUAUAGUU

    Hu, Ms, Rt

    MIMAT0000066

    3

    hsa-let-7g-5p

    UGAGGUAGUAGUUUGUACAGUU

    Hu, Ms, Rt

    MIMAT0000414

    4

    hsa-miR-100-5p

    AACCCGUAGAUCCGAACUUGUG

    Hu, Ms, Rt

    MIMAT0000098

    5

    hsa-miR-10a-5p

    UACCCUGUAGAUCCGAAUUUGUG

    Hu, Ms, Rt

    MIMAT0000253

    6

    hsa-miR-122-5p

    UGGAGUGUGACAAUGGUGUUUG

    Hu, Ms, Rt

    MIMAT0000421

    7

    hsa-miR-125b-5p

    UCCCUGAGACCCUAACUUGUGA

    Hu, Ms, Rt

    MIMAT0000423

    8

    hsa-miR-126-3p

    UCGUACCGUGAGUAAUAAUGCG

    Hu, Ms, Rt

    MIMAT0000445

    9

    hsa-miR-130a-3p

    CAGUGCAAUGUUAAAAGGGCAU

    Hu, Ms, Rt

    MIMAT0000425

    10

    hsa-miR-130b-3p

    CAGUGCAAUGAUGAAAGGGCAU

    Hu, Ms, Rt

    MIMAT0000691

    11

    hsa-miR-132-3p

    UAACAGUCUACAGCCAUGGUCG

    Hu, Ms, Rt

    MIMAT0000426

    12

    hsa-miR-134-5p

    UGUGACUGGUUGACCAGAGGGG

    Hu, Ms, Rt

    MIMAT0000447

    13

    hsa-miR-138-5p

    AGCUGGUGUUGUGAAUCAGGCCG

    Hu, Ms, Rt

    MIMAT0000430

    14

    hsa-miR-140-3p

    UACCACAGGGUAGAACCACGG

    Hu, Ms, Rt

    MIMAT0004597

    15

    hsa-miR-142-3p

    UGUAGUGUUUCCUACUUUAUGGA

    Hu, Ms, Rt

    MIMAT0000434

    16

    hsa-miR-143-3p

    UGAGAUGAAGCACUGUAGCUC

    Hu,Ms

    MIMAT0000435

    17

    hsa-miR-145-5p

    GUCCAGUUUUCCCAGGAAUCCCU

    Hu, Ms, Rt

    MIMAT0000437

    18

    hsa-miR-146a-5p

    UGAGAACUGAAUUCCAUGGGUU

    Hu, Ms, Rt

    MIMAT0000449

    19

    hsa-miR-146b-5p

    UGAGAACUGAAUUCCAUAGGCU

    Hu,Ms

    MIMAT0002809

    20

    mmu-miR-155-5p

    UUAAUGCUAAUUGUGAUAGGGGU

    Ms, Rt

    MIMAT0000165

    21

    hsa-miR-15a-5p

    UAGCAGCACAUAAUGGUUUGUG

    Hu,Ms

    MIMAT0000068

    22

    hsa-miR-15b-5p

    UAGCAGCACAUCAUGGUUUACA

    Hu, Ms, Rt

    MIMAT0000417

    23

    hsa-miR-16-5p

    UAGCAGCACGUAAAUAUUGGCG

    Hu, Ms, Rt

    MIMAT0000069

    24

    hsa-miR-17-5p

    CAAAGUGCUUACAGUGCAGGUAG

    Hu, Ms, Rt

    MIMAT0000070

    25

    hsa-miR-181a-5p

    AACAUUCAACGCUGUCGGUGAGU

    Hu, Ms, Rt

    MIMAT0000256

    26

    mmu-miR-182-5p

    UUUGGCAAUGGUAGAACUCACACCG

    Ms, Rt

    MIMAT0000211

    27

    rno-miR-183-5p

    UAUGGCACUGGUAGAAUUCACU

    Hu, Ms, Rt

    MIMAT0000860

    28

    hsa-miR-186-5p

    CAAAGAAUUCUCCUUUUGGGCU

    Hu, Ms, Rt

    MIMAT0000456

    29

    hsa-miR-18a-5p

    UAAGGUGCAUCUAGUGCAGAUAG

    Hu, Ms, Rt

    MIMAT0000072

    30

    hsa-miR-191-5p

    CAACGGAAUCCCAAAAGCAGCUG

    Hu, Ms, Rt

    MIMAT0000440

    31

    hsa-miR-192-5p

    CUGACCUAUGAAUUGACAGCC

    Hu, Ms, Rt

    MIMAT0000222

    32

    hsa-miR-194-5p

    UGUAACAGCAACUCCAUGUGGA

    Hu, Ms, Rt

    MIMAT0000460

    33

    hsa-miR-19a-3p

    UGUGCAAAUCUAUGCAAAACUGA

    Hu, Ms, Rt

    MIMAT0000073

    34

    hsa-miR-200a-3p

    UAACACUGUCUGGUAACGAUGU

    Hu, Ms, Rt

    MIMAT0000682

    35

    hsa-miR-200c-3p

    UAAUACUGCCGGGUAAUGAUGGA

    Hu,Ms

    MIMAT0000617

    36

    hsa-miR-203a-3p

    GUGAAAUGUUUAGGACCACUAG

    Hu, Ms, Rt

    MIMAT0000264

    37

    hsa-miR-206

    UGGAAUGUAAGGAAGUGUGUGG

    Hu, Ms, Rt

    MIMAT0000462

    38

    hsa-miR-20b-5p

    CAAAGUGCUCAUAGUGCAGGUAG

    Hu, Ms, Rt

    MIMAT0001413

    39

    hsa-miR-210-3p

    CUGUGCGUGUGACAGCGGCUGA

    Hu, Ms, Rt

    MIMAT0000267

    40

    mmu-miR-212-3p

    UAACAGUCUCCAGUCACGGCCA

    Ms, Rt

    MIMAT0000659

    41

    hsa-miR-214-3p

    ACAGCAGGCACAGACAGGCAGU

    Hu,Ms

    MIMAT0000271

    42

    hsa-miR-21-5p

    UAGCUUAUCAGACUGAUGUUGA

    Hu, Ms, Rt

    MIMAT0000076

    43

    hsa-miR-218-5p

    UUGUGCUUGAUCUAACCAUGU

    Hu, Ms, Rt

    MIMAT0000275

    44

    hsa-miR-223-3p

    UGUCAGUUUGUCAAAUACCCCA

    Hu,Ms

    MIMAT0000280

    45

    hsa-miR-23b-3p

    AUCACAUUGCCAGGGAUUACC

    Hu, Ms, Rt

    MIMAT0000418

    46

    hsa-miR-26b-5p

    UUCAAGUAAUUCAGGAUAGGU

    Hu, Ms, Rt

    MIMAT0000083

    47

    hsa-miR-27a-3p

    UUCACAGUGGCUAAGUUCCGC

    Hu, Ms, Rt

    MIMAT0000084

    48

    hsa-miR-29a-3p

    UAGCACCAUCUGAAAUCGGUUA

    Hu, Ms, Rt

    MIMAT0000086

    49

    hsa-miR-30a-5p

    UGUAAACAUCCUCGACUGGAAG

    Hu, Ms, Rt

    MIMAT0000087

    50

    hsa-miR-30c-5p

    UGUAAACAUCCUACACUCUCAGC

    Hu, Ms, Rt

    MIMAT0000244

    51

    hsa-miR-30e-3p

    CUUUCAGUCGGAUGUUUACAGC

    Hu, Ms, Rt

    MIMAT0000693

    52

    hsa-miR-320a

    AAAAGCUGGGUUGAGAGGGCGA

    Hu, Ms, Rt

    MIMAT0000510

    53

    hsa-miR-342-3p

    UCUCACACAGAAAUCGCACCCGU

    Hu, Ms, Rt

    MIMAT0000753

    54

    hsa-miR-34a-5p

    UGGCAGUGUCUUAGCUGGUUGU

    Hu, Ms, Rt

    MIMAT0000255

    55

    hsa-miR-34c-5p

    AGGCAGUGUAGUUAGCUGAUUGC

    Hu, Ms, Rt

    MIMAT0000686

    56

    mmu-miR-378a-3p

    ACUGGACUUGGAGUCAGAAGG

    Ms, Rt

    MIMAT0003151

    57

    hsa-miR-409-3p

    GAAUGUUGCUCGGUGAACCCCU

    Hu,Ms

    MIMAT0001639

    58

    hsa-miR-455-5p

    UAUGUGCCUUUGGACUACAUCG

    Hu, Ms, Rt

    MIMAT0003150

    59

    hsa-miR-484

    UCAGGCUCAGUCCCCUCCCGAU

    Hu, Ms, Rt

    MIMAT0002174

    60

    hsa-miR-486-5p

    UCCUGUACUGAGCUGCCCCGAG

    Hu, Ms, Rt

    MIMAT0002177

    61

    mmu-miR-489-3p

    AAUGACACCACAUAUAUGGCAGC

    Ms, Rt

    MIMAT0003112

    62

    hsa-miR-494-3p

    UGAAACAUACACGGGAAACCUC

    Hu,Ms

    MIMAT0002816

    63

    hsa-miR-532-3p

    CCUCCCACACCCAAGGCUUGCA

    Hu, Ms, Rt

    MIMAT0004780

    64

    hsa-miR-93-5p

    CAAAGUGCUGUUCGUGCAGGUAG

    Hu, Ms, Rt

    MIMAT0000093

    65

    hsa-miR-98-5p

    UGAGGUAGUAAGUUGUAUUGUU

    Hu, Ms, Rt

    MIMAT0000096

    66

    ath-mir167d

    UGAAGCUGCCAGCAUGAUCUGG

    Ath

    MIMAT0000905

    67

    cel-mir-70-3p

    UAAUACGUCGUUGGUGUUUCCAU

    Cel

    MIMAT0000042

    68

    oan-miR-7417-5p

    UUCCCCACUCUGAGCACACAGC

    Oan

    MIMAT0028982

    69

    x-control

    x-control

    N/A

     

    70

    blank

    blank

    N/A

     

  • Platform
    Multiplex

Properties

  • Storage instructions
    Store at +4°C. Please refer to protocols.
  • Components 1 x 48 tests 1 x 96 tests
    FirePlex® Particle Mix (Circulating) 1 x 1750µl 1 x 3500µl

Protocols

References

ab219508 has not yet been referenced specifically in any publications.

Customer reviews and Q&As

There are currently no Customer reviews or Questions for ab219508.
Please use the links above to contact us or submit feedback about this product.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"

Sign up