
FirePlex miRNA Panel – Oncology V2 (ab218367)
Key features and details
- Assay type: Multiplex
- Detection method: Flow cytometry-fluorescent
- Platform: Multiplex
- Assay time: 4 hr
Overview
-
Product name
FirePlex miRNA Panel – Oncology V2 -
Detection method
Flow cytometry-fluorescent -
Assay type
Multiplex -
Assay time
4h 00m -
Species reactivity
Reacts with: Mouse, Rat, Human -
Product overview
Multiplex miRNA Assay - Oncology panel (ab218367) are the FirePlex® particles designed to profile up to 65 literature curated miRNA for oncology studies, miRNAs differentially regulated in one or more solid cancers.
NOTE: FirePlex miRNA panels require the purchase of a Run Buffer. Use our FirePlex Cytometer Setup Kit V2 (ab245835) to select the most appropriate Run Buffer for your flow cytometer.
Our multiplex miRNA assays use our FirePlex® particle technology with the same sensitivity as PCR, they can be used either directly with 10 µL of biofluids such as serum or plasma with no need for RNA purification; or with 100 pg of purified RNA.
For a full list of validated sample types, and to learn more about the performance and requirements of these assays, visit here.
These miRNAs have been chosen based on a detailed study of data in peer-reviewed journals and exhibit differential regulation in whole blood, plasma, serum, peripheral blood mononuclear cells (PBMCs) or isolated exosomes.
Included in the panel are general markers for multiple cancers, markers specific to specific cancer types, markers that may indicate hemolysis contamination in isolated plasma/serum/exosomes and internal controls to validate assay performance
It is important to use the normalization procedure in the FirePlex® Analysis Workbench Software to identify the miRNAs that can optimally be used for normalization with your samples. Three miRNAs that are likely to be stably expressed in biofluid samples and may be suitable have been included in this panel.
-
Notes
To use this product researchers must also purchase the appropriate Core Reagent Kit, either ab218365 for use with purified RNA or ab218342 for use with biofluids.
FirePlex® is a registered trade mark in the United States and is an unregistered trade mark elsewhere.
** Hu = Human, Ms = Mouse, Rt = Rat, Ath = Arabidopsis thaliana, Oan = Ornithorhynchus anatinus, Cel = Caenorhabditis elegans.
# miRNA 21 name miRNA Sequence (miRBase V21) Sequence homology ** MIMAT ID 1 hsa-let-7d-5p agagguaguagguugcauaguu Hu, Ms, Rt MIMAT0000065 2 hsa-let-7g-5p ugagguaguaguuuguacaguu Hu, Ms, Rt MIMAT0000414 3 hsa-let-7i-5p ugagguaguaguuugugcuguu Hu, Ms, Rt MIMAT0000415 4 hsa-miR-103a-3p agcagcauuguacagggcuauga Hu, Ms, Rt MIMAT0000101 5 hsa-miR-106a-5p aaaagugcuuacagugcagguag Hu MIMAT0000103 6 hsa-miR-106b-5p uaaagugcugacagugcagau Hu, Ms, Rt MIMAT0000680 7 hsa-miR-107 agcagcauuguacagggcuauca Hu, Ms, Rt MIMAT0000104 8 hsa-miR-10b-5p uacccuguagaaccgaauuugug Hu, Ms, Rt MIMAT0000254 9 hsa-miR-122-5p uggagugugacaaugguguuug Hu, Ms, Rt MIMAT0000421 10 hsa-miR-125b-5p ucccugagacccuaacuuguga Hu, Ms, Rt MIMAT0000423 11 hsa-miR-126-3p ucguaccgugaguaauaaugcg Hu, Ms, Rt MIMAT0000445 12 hsa-miR-127-3p ucggauccgucugagcuuggcu Hu, Ms, Rt MIMAT0000446 13 hsa-miR-130a-3p cagugcaauguuaaaagggcau Hu, Ms, Rt MIMAT0000425 14 hsa-miR-141-3p uaacacugucugguaaagaugg Hu, Ms, Rt MIMAT0000432 15 hsa-miR-145-5p guccaguuuucccaggaaucccu Hu, Ms, Rt MIMAT0000437 16 hsa-miR-146a-5p ugagaacugaauuccauggguu Hu, Ms, Rt MIMAT0000449 17 hsa-miR-148a-3p ucagugcacuacagaacuuugu Hu, Ms MIMAT0000243 18 hsa-miR-148b-3p ucagugcaucacagaacuuugu Hu, Ms, Rt MIMAT0000759 19 hsa-miR-150-5p ucucccaacccuuguaccagug Hu, Ms, Rt MIMAT0000451 20 hsa-miR-151a-3p cuagacugaagcuccuugagg Hu MIMAT0000757 21 hsa-miR-155-5p uuaaugcuaaucgugauaggggu Hu MIMAT0000646 22 hsa-miR-15b-5p uagcagcacaucaugguuuaca Hu, Ms, Rt MIMAT0000417 23 hsa-miR-16-5p uagcagcacguaaauauuggcg Hu, Ms, Rt MIMAT0000069 24 hsa-miR-17-5p caaagugcuuacagugcagguag Hu, Ms, Rt MIMAT0000070 25 hsa-miR-181a-5p aacauucaacgcugucggugagu Hu, Ms, Rt MIMAT0000256 26 hsa-miR-181b-5p aacauucauugcugucggugggu Hu, Ms, Rt MIMAT0000257 27 hsa-miR-182-5p uuuggcaaugguagaacucacacu Hu MIMAT0000259 28 hsa-miR-187-3p ucgugucuuguguugcagccgg Hu, Ms, Rt MIMAT0000262 29 hsa-miR-18a-5p uaaggugcaucuagugcagauag Hu, Ms, Rt MIMAT0000072 30 hsa-miR-192-5p cugaccuaugaauugacagcc Hu, Ms, Rt MIMAT0000222 31 hsa-miR-195-5p uagcagcacagaaauauuggc Hu, Ms, Rt MIMAT0000461 32 hsa-miR-199a-3p acaguagucugcacauugguua Hu, Ms, Rt MIMAT0000232 33 hsa-miR-199a-5p cccaguguucagacuaccuguuc Hu, Ms, Rt MIMAT0000231 34 hsa-miR-19a-3p ugugcaaaucuaugcaaaacuga Hu, Ms, Rt MIMAT0000073 35 hsa-miR-200b-3p uaauacugccugguaaugauga Hu, Ms MIMAT0000318 36 hsa-miR-200c-3p uaauacugccggguaaugaugga Hu, Ms MIMAT0000617 37 hsa-miR-205-5p uccuucauuccaccggagucug Hu, Ms MIMAT0000266 38 hsa-miR-20a-5p uaaagugcuuauagugcagguag Hu, Ms, Rt MIMAT0000075 39 hsa-miR-210-3p cugugcgugugacagcggcuga Hu, Ms, Rt MIMAT0000267 40 hsa-miR-21-5p uagcuuaucagacugauguuga Hu, Ms, Rt MIMAT0000076 41 ath-mir167d ugaagcugccagcaugaucugg Ath MIMAT0000905 42 hsa-miR-221-3p agcuacauugucugcuggguuuc Hu, Ms, Rt MIMAT0000278 43 hsa-miR-222-3p agcuacaucuggcuacugggu Hu, Ms, Rt MIMAT0000279 44 hsa-miR-223-3p ugucaguuugucaaauacccca Hu, Ms MIMAT0000280 45 hsa-miR-22-3p aagcugccaguugaagaacugu Hu, Ms, Rt MIMAT0000077 46 hsa-miR-25-3p cauugcacuugucucggucuga Hu, Ms, Rt MIMAT0000081 47 hsa-miR-26a-5p uucaaguaauccaggauaggcu Hu, Ms, Rt MIMAT0000082 48 hsa-miR-27a-3p uucacaguggcuaaguuccgc Hu, Ms, Rt MIMAT0000084 49 hsa-miR-29a-3p uagcaccaucugaaaucgguua Hu, Ms, Rt MIMAT0000086 50 hsa-miR-29b-3p uagcaccauuugaaaucaguguu Hu, Ms, Rt MIMAT0000100 51 hsa-miR-29c-3p uagcaccauuugaaaucgguua Hu, Ms, Rt MIMAT0000681 52 hsa-miR-320a aaaagcuggguugagagggcga Hu, Ms, Rt MIMAT0000510 53 hsa-miR-335-5p ucaagagcaauaacgaaaaaugu Hu, Ms, Rt MIMAT0000765 54 hsa-miR-34a-5p uggcagugucuuagcugguugu Hu, Ms, Rt MIMAT0000255 55 hsa-miR-34b-3p caaucacuaacuccacugccau Hu MIMAT0004676 56 hsa-miR-375 uuuguucguucggcucgcguga Hu, Ms, Rt MIMAT0000728 57 hsa-miR-376c-3p aacauagaggaaauuccacgu Hu MIMAT0000720 58 hsa-miR-378a-3p acuggacuuggagucagaaggc Hu MIMAT0000732 59 hsa-miR-409-3p gaauguugcucggugaaccccu Hu, Ms MIMAT0001639 60 hsa-miR-451a aaaccguuaccauuacugaguu Hu, Ms, Rt MIMAT0001631 61 hsa-miR-483-5p aagacgggaggaaagaagggag Hu MIMAT0004761 62 hsa-miR-486-5p uccuguacugagcugccccgag Hu, Ms, Rt MIMAT0002177 63 hsa-miR-574-3p cacgcucaugcacacacccaca Hu, Ms MIMAT0003239 64 cel-mir-70-3p uaauacgucguugguguuuccau Cel MIMAT0000042 65 hsa-miR-652-3p aauggcgccacuaggguugug Hu, Ms, Rt MIMAT0003322 66 hsa-miR-92a-3p uauugcacuugucccggccugu Hu MIMAT0000092 67 hsa-miR-93-5p caaagugcuguucgugcagguag Hu, Ms, Rt MIMAT0000093 68 oan-miR-7417-5p uuccccacucugagcacacagc Oan MIMAT0028982 69 x-control x-control N/A 70 blank blank N/A -
Platform
Multiplex
Properties
-
Storage instructions
Store at +4°C. Please refer to protocols. -
Components 1 x 48 tests 1 x 96 tests FirePlex® Particle Mix (Circulating) 1 x 1750µl 1 x 3500µl
Associated products
-
Related Buffer
-
Related Products
Images
-
Background-subtracted, normalized with geometric average of three samples of plasma and 3 samples of sera.
Samples of human plasma and sera were run in triplicate on the Circulating Oncology Fixed Panel using the Multiplex Circulating miRNA Assay (biofluids). Results were background subtracted and normalized using geometric average, profiling 68 miRNAs per well for each sample.
Datasheets and documents
-
SDS download
-
Datasheet download
References (2)
ab218367 has been referenced in 2 publications.
- Hoss AG et al. miR-10b-5p expression in Huntington's disease brain relates to age of onset and the extent of striatal involvement. BMC Med Genomics 8:10 (2015). PubMed: 25889241
- Le MT et al. miR-200-containing extracellular vesicles promote breast cancer cell metastasis. J Clin Invest 124:5109-28 (2014). PubMed: 25401471