
  • Product name
    FirePlex® miRNA Panel – Cardiology V2
  • Detection method
    Flow cytometry-fluorescent
  • Assay type
  • Assay time
    4h 00m
  • Species reactivity
    Reacts with: Mouse, Rat, Human
  • Product overview

    Multiplex miRNA Assay - Cardiology Panel (ab218368) are the FirePlex® particles designed to profile up to 65 literature curated miRNA for cardiology studies, miRNAs (see miRNA list) differentially regulated in normal or abnormal cardiovascular health.

    NOTE: FirePlex miRNA panels require the purchase of a Run Buffer. Use our FirePlex Cytometer Setup Kit (ab211043) to select the most appropriate Run Buffer for your flow cytometer.

    Our multiplex miRNA assays use our FirePlex® particle technology with the same sensitivity as PCR, they can be used either directly with 10 µL of biofluids such as serum or plasma with no need for RNA purification; or with 100 pg of purified RNA.

    For a full list of validated sample types, and to learn more about the performance and requirements of these assays, visit https://www.abcam.com/nav/multiplex-mirna-assays.

    These miRNAs have been chosen based on a detailed study of data in peer-reviewed journals and exhibit differential regulation in whole blood, plasma, serum, peripheral blood mononuclear cells (PBMCs) or isolated exosomes.

    Included in the panel are general markers for multiple cardiovascular-related diseases, markers specific to specific cardiovascular states or treatment responses, markers that may indicate hemolysis contamination in isolated plasma/serum/exosomes and internal controls to validate assay performance.

    It is important to use the normalization procedure in the FirePlex® Analysis Workbench Software to identify the miRNAs that can optimally be used for normalization with your samples. Three miRNAs that are likely to be stably expressed in biofluid samples and may be suitable have been included in this panel.

  • Notes

    To use this product researchers must also purchase the appropriate Core Reagent Kit, either ab218365 for use with purified RNA or ab218342 for use with biofluids. 

    FirePlex® is a registered trade mark in the United States and is an unregistered trade mark elsewhere. 

    ** Hu = Human, Ms = Mouse, Rt = Rat, Ath = Arabidopsis thaliana, Oan = Ornithorhynchus anatinus, Cel = Caenorhabditis elegans.

    # miRNA 21 name miRNA Sequence (miRBase V21) Sequence homology ** MIMAT ID
    1 hsa-let-7d-5p agagguaguagguugcauaguu Hu, Ms, Rt MIMAT0000065
    2 hsa-let-7e-5p ugagguaggagguuguauaguu Hu, Ms, Rt MIMAT0000066
    3 hsa-let-7g-5p ugagguaguaguuuguacaguu Hu, Ms, Rt MIMAT0000414
    4 hsa-let-7i-5p ugagguaguaguuugugcuguu Hu, Ms, Rt MIMAT0000415
    5 hsa-miR-1-3p uggaauguaaagaaguauguau Hu, Ms, Rt MIMAT0000416
    6 hsa-miR-103a-3p agcagcauuguacagggcuauga Hu, Ms, Rt MIMAT0000101
    7 hsa-miR-106b-5p uaaagugcugacagugcagau Hu, Ms, Rt MIMAT0000680
    8 hsa-miR-122-5p uggagugugacaaugguguuug Hu, Ms, Rt MIMAT0000421
    9 hsa-miR-124-3p uaaggcacgcggugaaugcc Hu, Ms, Rt MIMAT0000422
    10 hsa-miR-125a-5p ucccugagacccuuuaaccuguga Hu, Ms, Rt MIMAT0000443
    11 hsa-miR-125b-5p ucccugagacccuaacuuguga Hu, Ms, Rt MIMAT0000423
    12 hsa-miR-126-3p ucguaccgugaguaauaaugcg Hu, Ms, Rt MIMAT0000445
    13 hsa-miR-133a-3p uuugguccccuucaaccagcug Hu, Ms, Rt MIMAT0000427
    14 hsa-miR-133b uuugguccccuucaaccagcua Hu, Ms, Rt MIMAT0000770
    15 hsa-miR-142-3p uguaguguuuccuacuuuaugga Hu, Ms, Rt MIMAT0000434
    16 hsa-miR-144-5p ggauaucaucauauacuguaag Hu MIMAT0004600
    17 hsa-miR-145-5p guccaguuuucccaggaaucccu Hu, Ms, Rt MIMAT0000437
    18 hsa-miR-146a-5p ugagaacugaauuccauggguu Hu, Ms, Rt MIMAT0000449
    19 hsa-miR-150-5p ucucccaacccuuguaccagug Hu, Ms, Rt MIMAT0000451
    20 hsa-miR-155-5p uuaaugcuaaucgugauaggggu Hu MIMAT0000646
    21 hsa-miR-15b-5p uagcagcacaucaugguuuaca Hu, Ms, Rt MIMAT0000417
    22 hsa-miR-16-5p uagcagcacguaaauauuggcg Hu, Ms, Rt MIMAT0000069
    23 hsa-miR-17-5p caaagugcuuacagugcagguag Hu, Ms, Rt MIMAT0000070
    24 hsa-miR-181b-5p aacauucauugcugucggugggu Hu, Ms, Rt MIMAT0000257
    25 hsa-miR-18a-5p uaaggugcaucuagugcagauag Hu, Ms, Rt MIMAT0000072
    26 hsa-miR-192-5p cugaccuaugaauugacagcc Hu, Ms, Rt MIMAT0000222
    27 hsa-miR-194-5p uguaacagcaacuccaugugga Hu, Ms, Rt MIMAT0000460
    28 hsa-miR-195-5p uagcagcacagaaauauuggc Hu, Ms, Rt MIMAT0000461
    29 hsa-miR-199a-3p acaguagucugcacauugguua Hu, Ms, Rt MIMAT0000232
    30 hsa-miR-199a-5p cccaguguucagacuaccuguuc Hu, Ms, Rt MIMAT0000231
    31 hsa-miR-19a-3p ugugcaaaucuaugcaaaacuga Hu, Ms, Rt MIMAT0000073
    32 hsa-miR-208a-3p auaagacgagcaaaaagcuugu Hu, Ms MIMAT0000241
    33 hsa-miR-208b-3p auaagacgaacaaaagguuugu Hu, Ms MIMAT0004960
    34 hsa-miR-20b-5p caaagugcucauagugcagguag Hu, Ms, Rt MIMAT0001413
    35 hsa-miR-210-3p cugugcgugugacagcggcuga Hu, Ms, Rt MIMAT0000267
    36 hsa-miR-214-3p acagcaggcacagacaggcagu Hu, Ms MIMAT0000271
    37 hsa-miR-21-5p uagcuuaucagacugauguuga Hu, Ms, Rt MIMAT0000076
    38 hsa-miR-25-3p cauugcacuugucucggucuga Hu, Ms, Rt MIMAT0000081
    39 hsa-miR-26a-5p uucaaguaauccaggauaggcu Hu, Ms, Rt MIMAT0000082
    40 hsa-miR-26b-5p uucaaguaauucaggauaggu Hu, Ms, Rt MIMAT0000083
    41 hsa-miR-27a-3p uucacaguggcuaaguuccgc Hu, Ms, Rt MIMAT0000084
    42 hsa-miR-27b-3p uucacaguggcuaaguucugc Hu, Ms, Rt MIMAT0000419
    43 hsa-miR-28-5p aaggagcucacagucuauugag Hu, Ms, Rt MIMAT0000085
    44 hsa-miR-29a-3p uagcaccaucugaaaucgguua Hu, Ms, Rt MIMAT0000086
    45 hsa-miR-29b-3p uagcaccauuugaaaucaguguu Hu, Ms, Rt MIMAT0000100
    46 hsa-miR-30a-5p uguaaacauccucgacuggaag Hu, Ms, Rt MIMAT0000087
    47 ath-mir167d ugaagcugccagcaugaucugg Ath MIMAT0000905
    48 hsa-miR-320b aaaagcuggguugagagggcaa Hu MIMAT0005792
    49 hsa-miR-328-3p cuggcccucucugcccuuccgu Hu, Ms, Rt MIMAT0000752
    50 hsa-miR-335-5p ucaagagcaauaacgaaaaaugu Hu, Ms, Rt MIMAT0000765
    51 hsa-miR-337-5p gaacggcuucauacaggaguu Hu MIMAT0004695
    52 hsa-miR-342-3p ucucacacagaaaucgcacccgu Hu, Ms, Rt MIMAT0000753
    53 hsa-miR-34a-5p uggcagugucuuagcugguugu Hu, Ms, Rt MIMAT0000255
    54 hsa-miR-363-3p aauugcacgguauccaucugua Hu MIMAT0000707
    55 hsa-miR-370-3p gccugcugggguggaaccuggu Hu, Ms, Rt MIMAT0000722
    56 oan-miR-7417-5p uuccccacucugagcacacagc Oan MIMAT0028982
    57 hsa-miR-375 uuuguucguucggcucgcguga Hu, Ms, Rt MIMAT0000728
    58 cel-mir-70-3p uaauacgucguugguguuuccau Cel MIMAT0000042
    59 hsa-miR-423-5p ugaggggcagagagcgagacuuu Hu, Ms MIMAT0004748
    60 hsa-miR-433-3p aucaugaugggcuccucggugu Hu, Ms, Rt MIMAT0001627
    61 hsa-miR-451a aaaccguuaccauuacugaguu Hu, Ms, Rt MIMAT0001631
    62 hsa-miR-485-3p gucauacacggcucuccucucu Hu MIMAT0002176
    63 hsa-miR-486-5p uccuguacugagcugccccgag Hu, Ms, Rt MIMAT0002177
    64 hsa-miR-499a-5p uuaagacuugcagugauguuu Hu, Ms, Rt MIMAT0002870
    65 hsa-miR-505-5p gggagccaggaaguauugaugu Hu MIMAT0004776
    66 hsa-miR-590-5p gagcuuauucauaaaagugcag Hu, Ms MIMAT0003258
    67 hsa-miR-92a-3p uauugcacuugucccggccugu Hu MIMAT0000092
    68 hsa-miR-93-5p caaagugcuguucgugcagguag Hu, Ms, Rt MIMAT0000093
    69 x-control x-control N/A  
    70 blank blank N/A  


  • Platform


  • Storage instructions
    Store at +4°C. Please refer to protocols.
  • Components 1 x 48 tests 1 x 96 tests
    FirePlex® Particle Mix (Circulating) 1 x 1750µl 1 x 3500µl



This product has been referenced in:
  • Hoss AG  et al. miR-10b-5p expression in Huntington's disease brain relates to age of onset and the extent of striatal involvement. BMC Med Genomics 8:10 (2015). Read more (PubMed: 25889241) »
See 1 Publication for this product

Customer reviews and Q&As

There are currently no Customer reviews or Questions for ab218368.
Please use the links above to contact us or submit feedback about this product.


Sign up