Overview

  • Product name
    FirePlex® miRNA Panel – Immunology V2
  • Detection method
    Flow cytometry-fluorescent
  • Assay type
    Multiplex
  • Assay time
    4h 00m
  • Species reactivity
    Reacts with: Mouse, Rat, Human
  • Product overview

    Multiplex miRNA Assay - Immunology Panel (ab218369) are the FirePlex® particles designed to profile up to 65 literature curated miRNA for immunology studies, miRNAs differentially regulated in normal or abnormal immunological health.


    NOTE: FirePlex miRNA panels require the purchase of a Run Buffer. Use our FirePlex Cytometer Setup Kit V2 (ab245835) to select the most appropriate Run Buffer for your flow cytometer.


    Our multiplex miRNA assays use our FirePlex® particle technology with the same sensitivity as PCR, they can be used either directly with 10 µL of biofluids such as serum or plasma with no need for RNA purification; or with 100 pg of purified RNA.


    Find a full list of validated sample types, and learn more about the performance and requirements of these assays, here.


    These miRNAs have been chosen based on a detailed study of data in peer-reviewed journals and exhibit differential regulation in whole blood, plasma, serum, peripheral blood mononuclear cells (PBMCs) or isolated exosomes.


    Included in the panel are general markers for multiple immunology-related diseases, markers specific to specific autoimmune diseases and blood-based cancers, markers that may indicate hemolysis contamination in isolated plasma/serum/exosomes and internal controls to validate assay performance.


    It is important to use the normalization procedure in the FirePlex® Analysis Workbench Software to identify the miRNAs that can optimally be used for normalization with your samples. Three miRNAs that are likely to be stably expressed in biofluid samples and may be suitable have been included in this panel.

  • Notes

    To use this product researchers must also purchase the appropriate Core Reagent Kit, either ab218365 for use with purified RNA or ab218342 for use with biofluids. 

    FirePlex® is a registered trade mark in the United States and is an unregistered trade mark elsewhere. 

    ** Hu = Human, Ms = Mouse, Rt = Rat, Ath = Arabidopsis thaliana, Oan = Ornithorhynchus anatinus, Cel = Caenorhabditis elegans. 

     # miRNA 21 name miRNA Sequence (miRBase V21) Sequence homology ** MIMAT ID
     1 hsa-let-7b-5p ugagguaguagguugugugguu Hu, Ms, Rt MIMAT0000063
     2 hsa-let-7d-5p agagguaguagguugcauaguu Hu, Ms, Rt MIMAT0000065
     3 ath-mir167d ugaagcugccagcaugaucugg Ath MIMAT0000905
     4 hsa-let-7g-5p ugagguaguaguuuguacaguu Hu, Ms, Rt MIMAT0000414
     5 hsa-let-7i-5p ugagguaguaguuugugcuguu Hu, Ms, Rt MIMAT0000415
     6 hsa-miR-10a-5p uacccuguagauccgaauuugug Hu, Ms, Rt MIMAT0000253
     7 hsa-miR-122-5p uggagugugacaaugguguuug Hu, Ms, Rt MIMAT0000421
     8 hsa-miR-1246 aauggauuuuuggagcagg Hu MIMAT0005898
     9 hsa-miR-125a-5p ucccugagacccuuuaaccuguga Hu, Ms, Rt MIMAT0000443
     10 hsa-miR-126-3p ucguaccgugaguaauaaugcg Hu, Ms, Rt MIMAT0000445
     11 hsa-miR-129-5p cuuuuugcggucugggcuugc Hu, Ms, Rt MIMAT0000242
     12 hsa-miR-130a-3p cagugcaauguuaaaagggcau Hu, Ms, Rt MIMAT0000425
     13 hsa-miR-132-3p uaacagucuacagccauggucg Hu, Ms, Rt MIMAT0000426
     14 hsa-miR-140-3p uaccacaggguagaaccacgg Hu, Ms, Rt MIMAT0004597
     15 hsa-miR-142-3p uguaguguuuccuacuuuaugga Hu, Ms, Rt MIMAT0000434
     16 hsa-miR-145-5p guccaguuuucccaggaaucccu Hu, Ms, Rt MIMAT0000437
     17 hsa-miR-146a-5p ugagaacugaauuccauggguu Hu, Ms, Rt MIMAT0000449
     18 hsa-miR-150-5p ucucccaacccuuguaccagug Hu, Ms, Rt MIMAT0000451
     19 hsa-miR-151a-5p ucgaggagcucacagucuagu Hu, Ms, Rt MIMAT0004697
     20 hsa-miR-154-3p aaucauacacgguugaccuauu Hu, Ms, Rt MIMAT0000453
     21 hsa-miR-155-5p uuaaugcuaaucgugauaggggu Hu MIMAT0000646
     22 hsa-miR-15a-5p uagcagcacauaaugguuugug Hu, Ms MIMAT0000068
    23 hsa-miR-15b-5p uagcagcacaucaugguuuaca Hu, Ms, Rt MIMAT0000417
    24 hsa-miR-16-5p uagcagcacguaaauauuggcg Hu, Ms, Rt MIMAT0000069
    25 cel-mir-70-3p uaauacgucguugguguuuccau Cel MIMAT0000042
    26 hsa-miR-17-5p caaagugcuuacagugcagguag Hu, Ms, Rt MIMAT0000070
    27 hsa-miR-181a-5p aacauucaacgcugucggugagu Hu, Ms, Rt MIMAT0000256
    28 hsa-miR-181b-5p aacauucauugcugucggugggu Hu, Ms, Rt MIMAT0000257
    29 hsa-miR-185-5p uggagagaaaggcaguuccuga Hu, Ms, Rt MIMAT0000455
    30 hsa-miR-192-5p cugaccuaugaauugacagcc Hu, Ms, Rt MIMAT0000222
    31 hsa-miR-196a-5p uagguaguuucauguuguuggg Hu, Ms, Rt MIMAT0000226
    32 hsa-miR-200a-3p uaacacugucugguaacgaugu Hu, Ms, Rt MIMAT0000682
    33 hsa-miR-203a-3p gugaaauguuuaggaccacuag Hu, Ms, Rt MIMAT0000264
    34 hsa-miR-205-5p uccuucauuccaccggagucug Hu, Ms MIMAT0000266
    35 hsa-miR-20a-5p uaaagugcuuauagugcagguag Hu, Ms, Rt MIMAT0000075
    36 hsa-miR-20b-5p caaagugcucauagugcagguag Hu, Ms, Rt MIMAT0001413
    37 hsa-miR-21-5p uagcuuaucagacugauguuga Hu, Ms, Rt MIMAT0000076
    38 hsa-miR-210-3p cugugcgugugacagcggcuga Hu, Ms, Rt MIMAT0000267
    39 hsa-miR-22-3p aagcugccaguugaagaacugu Hu, Ms, Rt MIMAT0000077
    40 hsa-miR-221-3p agcuacauugucugcuggguuuc Hu, Ms, Rt MIMAT0000278
    41 hsa-miR-223-3p ugucaguuugucaaauacccca Hu, Ms MIMAT0000280
    42 hsa-miR-23a-3p aucacauugccagggauuucc Hu, Ms, Rt MIMAT0000078
    43 hsa-miR-24-3p uggcucaguucagcaggaacag Hu, Ms, Rt MIMAT0000080
    44 hsa-miR-26a-5p uucaaguaauccaggauaggcu Hu, Ms, Rt MIMAT0000082
    45 hsa-miR-29a-3p uagcaccaucugaaaucgguua Hu, Ms, Rt MIMAT0000086
    46 hsa-miR-29b-3p uagcaccauuugaaaucaguguu Hu, Ms, Rt MIMAT0000100
    47 hsa-miR-29c-3p uagcaccauuugaaaucgguua Hu, Ms, Rt MIMAT0000681
    48 hsa-miR-30a-5p uguaaacauccucgacuggaag Hu, Ms, Rt MIMAT0000087
    49 hsa-miR-30b-5p uguaaacauccuacacucagcu Hu, Ms, Rt MIMAT0000420
    50 hsa-miR-320a aaaagcuggguugagagggcga Hu, Ms, Rt MIMAT0000510
    51 hsa-miR-320d aaaagcuggguugagagga Hu MIMAT0006764
    52 hsa-miR-339-5p ucccuguccuccaggagcucacg Hu, Ms, Rt MIMAT0000764
    53 hsa-miR-33a-5p gugcauuguaguugcauugca Hu, Ms, Rt MIMAT0000091
    54 hsa-miR-342-3p ucucacacagaaaucgcacccgu Hu, Ms, Rt MIMAT0000753
    55 hsa-miR-34a-5p uggcagugucuuagcugguugu Hu, Ms, Rt MIMAT0000255
    56 hsa-miR-375 uuuguucguucggcucgcguga Hu, Ms, Rt MIMAT0000728
    57 oan-miR-7417-5p uuccccacucugagcacacagc Oan MIMAT0028982
    58 hsa-miR-422a acuggacuuagggucagaaggc Hu MIMAT0001339
    59 hsa-miR-429 uaauacugucugguaaaaccgu Hu MIMAT0001536
      60 hsa-miR-431-3p caggucgucuugcagggcuucu Hu, Ms MIMAT0004757
      61 hsa-miR-451a aaaccguuaccauuacugaguu Hu, Ms, Rt MIMAT0001631
      62 hsa-miR-486-5p uccuguacugagcugccccgag Hu, Ms, Rt MIMAT0002177
    63 hsa-miR-494-3p ugaaacauacacgggaaaccuc Hu, Ms MIMAT0002816
      64 hsa-miR-523-5p cucuagagggaagcgcuuucug Hu MIMAT0005449
      65 hsa-miR-744-5p ugcggggcuagggcuaacagca Hu, Ms MIMAT0004945
      66 hsa-miR-885-5p uccauuacacuacccugccucu Hu MIMAT0004947
      67 hsa-miR-92a-3p uauugcacuugucccggccugu Hu MIMAT0000092
      68 hsa-miR-93-5p caaagugcuguucgugcagguag Hu, Ms, Rt MIMAT0000093
      69 x-control x-control N/A  
      70 blank blank N/A  

     

     

     

  • Platform
    Multiplex

Properties

  • Storage instructions
    Store at +4°C. Please refer to protocols.
  • Components 1 x 48 tests 1 x 96 tests
    FirePlex® Particle Mix (Circulating) 1 x 1750µl 1 x 3500µl

Images

  • Samples of human plasma and sera were run in triplicate on the Circulating Immunology Fixed Panel using the Multiplex Circulating miRNA Assay (biofluids). Results were background subtracted and normalized using geometric average, profiling 68 miRNAs per well for each sample.

Protocols

References

This product has been referenced in:
  • Hoss AG  et al. miR-10b-5p expression in Huntington's disease brain relates to age of onset and the extent of striatal involvement. BMC Med Genomics 8:10 (2015). Read more (PubMed: 25889241) »
See 1 Publication for this product

Customer reviews and Q&As

There are currently no Customer reviews or Questions for ab218369.
Please use the links above to contact us or submit feedback about this product.

Please note: All products are "FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES"
For licensing inquiries, please contact partnerships@abcam.com

Sign up