
  • Product name
    FirePlex® miRNA Panel – Liver Tox V2
  • Detection method
    Flow cytometry-fluorescent
  • Assay type
  • Assay time
    4h 00m
  • Species reactivity
    Reacts with: Mouse, Rat, Human
  • Product overview

    Multiplex miRNA Assay - Liver Tox Panel (ab218370) are the FirePlex® particles designed to profile up to 65 literature curated miRNA for liver toxicity.

    NOTE: FirePlex miRNA panels require the purchase of a Run Buffer. Use our FirePlex Cytometer Setup Kit V2 (ab245835) to select the most appropriate Run Buffer for your flow cytometer.

    Our multiplex miRNA assays use our FirePlex® particle technology with the same sensitivity as PCR, they can be used either directly with 10 µL of biofluids such as serum or plasma with no need for RNA purification; or with 100 pg of purified RNA.

    Find a full list of validated sample types, and learn more about the performance and requirements of these assays, here.

    These miRNAs have been chosen based on a detailed study of data in peer-reviewed journals and exhibit differential regulation in whole blood, plasma, serum, peripheral blood mononuclear cells (PBMCs) or isolated exosomes.

    It is important to use the normalization procedure in the FirePlex® Analysis Workbench Software to identify the miRNAs that can optimally be used for normalization with your samples. Three miRNAs that are likely to be stably expressed in biofluid samples and may be suitable have been included in this panel.

  • Notes

    To use this product researchers must also purchase the appropriate Core Reagent Kit, either ab218365 for use with purified RNA or ab218342 for use with biofluids. 

    FirePlex® is a registered trade mark in the United States and is an unregistered trade mark elsewhere. 

    ** Hu = Human, Ms = Mouse, Rt = Rat, Ath = Arabidopsis thaliana, Oan = Ornithorhynchus anatinus, Cel = Caenorhabditis elegans.  

    # miRNA 21 name miRNA Sequence (miRBase V21) Sequence homology ** MIMAT ID
    1 hsa-let-7d-5p agagguaguagguugcauaguu Hu, Ms, Rt MIMAT0000065
    2 hsa-let-7g-5p ugagguaguaguuuguacaguu Hu, Ms, Rt MIMAT0000414
    3 hsa-let-7i-5p ugagguaguaguuugugcuguu Hu, Ms, Rt MIMAT0000415
    4 hsa-miR-100-5p aacccguagauccgaacuugug Hu, Ms, Rt MIMAT0000098
    5 hsa-miR-101-3p uacaguacugugauaacugaa Hu, Ms, Rt MIMAT0000099
    6 hsa-miR-107 agcagcauuguacagggcuauca Hu, Ms, Rt MIMAT0000104
    7 hsa-miR-122-5p uggagugugacaaugguguuug Hu, Ms, Rt MIMAT0000421
    8 hsa-miR-124-3p uaaggcacgcggugaaugcc Hu, Ms, Rt MIMAT0000422
    9 hsa-miR-125b-5p ucccugagacccuaacuuguga Hu, Ms, Rt MIMAT0000423
    10 hsa-miR-130a-3p cagugcaauguuaaaagggcau Hu, Ms, Rt MIMAT0000425
    11 hsa-miR-146a-5p ugagaacugaauuccauggguu Hu, Ms, Rt MIMAT0000449
    12 hsa-miR-146b-5p ugagaacugaauuccauaggcu Hu, Ms MIMAT0002809
    13 hsa-miR-148a-3p ucagugcacuacagaacuuugu Hu, Ms MIMAT0000243
    14 hsa-miR-152-3p ucagugcaugacagaacuugg Hu, Ms, Rt MIMAT0000438
    15 mmu-miR-155-5p uuaaugcuaauugugauaggggu Ms, Rt MIMAT0000165
    16 hsa-miR-15a-5p uagcagcacauaaugguuugug Hu, Ms MIMAT0000068
    17 hsa-miR-16-5p uagcagcacguaaauauuggcg Hu, Ms, Rt MIMAT0000069
    18 hsa-miR-17-5p caaagugcuuacagugcagguag Hu, Ms, Rt MIMAT0000070
    19 hsa-miR-181a-5p aacauucaacgcugucggugagu Hu, Ms, Rt MIMAT0000256
    20 mmu-miR-182-5p uuuggcaaugguagaacucacaccg Ms, Rt MIMAT0000211
    21 hsa-miR-183-3p gugaauuaccgaagggccauaa Hu, Ms MIMAT0004560
    22 hsa-miR-183-5p uauggcacugguagaauucacu Hu, Ms, Rt MIMAT0000261
    23 hsa-miR-185-5p uggagagaaaggcaguuccuga Hu, Ms, Rt MIMAT0000455
    24 hsa-miR-18a-5p uaaggugcaucuagugcagauag Hu, Ms, Rt MIMAT0000072
    25 hsa-miR-192-5p cugaccuaugaauugacagcc Hu, Ms, Rt MIMAT0000222
    26 hsa-miR-193a-3p aacuggccuacaaagucccagu Hu, Ms, Rt MIMAT0000459
    27 hsa-miR-194-5p uguaacagcaacuccaugugga Hu, Ms, Rt MIMAT0000460
    28 hsa-miR-199a-3p acaguagucugcacauugguua Hu, Ms, Rt MIMAT0000232
    29 hsa-miR-199a-5p cccaguguucagacuaccuguuc Hu, Ms, Rt MIMAT0000231
    30 hsa-miR-19a-3p ugugcaaaucuaugcaaaacuga Hu, Ms, Rt MIMAT0000073
    31 hsa-miR-200a-3p uaacacugucugguaacgaugu Hu, Ms, Rt MIMAT0000682
    32 hsa-miR-200b-3p uaauacugccugguaaugauga Hu, Ms MIMAT0000318
    33 hsa-miR-206 uggaauguaaggaagugugugg Hu, Ms, Rt MIMAT0000462
    34 hsa-miR-210-3p cugugcgugugacagcggcuga Hu, Ms, Rt MIMAT0000267
    35 hsa-miR-214-3p acagcaggcacagacaggcagu Hu, Ms MIMAT0000271
    36 hsa-miR-21-5p uagcuuaucagacugauguuga Hu, Ms, Rt MIMAT0000076
    37 hsa-miR-221-3p agcuacauugucugcuggguuuc Hu, Ms, Rt MIMAT0000278
    38 hsa-miR-222-3p agcuacaucuggcuacugggu Hu, Ms, Rt MIMAT0000279
    39 hsa-miR-223-3p ugucaguuugucaaauacccca Hu, Ms MIMAT0000280
    40 hsa-miR-22-3p aagcugccaguugaagaacugu Hu, Ms, Rt MIMAT0000077
    41 hsa-miR-23b-3p aucacauugccagggauuacc Hu, Ms, Rt MIMAT0000418
    42 hsa-miR-24-3p uggcucaguucagcaggaacag Hu, Ms, Rt MIMAT0000080
    43 hsa-miR-26b-5p uucaaguaauucaggauaggu Hu, Ms, Rt MIMAT0000083
    44 hsa-miR-27b-3p uucacaguggcuaaguucugc Hu, Ms, Rt MIMAT0000419
    45 hsa-miR-29a-3p uagcaccaucugaaaucgguua Hu, Ms, Rt MIMAT0000086
    46 hsa-miR-29b-3p uagcaccauuugaaaucaguguu Hu, Ms, Rt MIMAT0000100
    47 hsa-miR-29c-3p uagcaccauuugaaaucgguua Hu, Ms, Rt MIMAT0000681
    48 hsa-miR-30a-5p uguaaacauccucgacuggaag Hu, Ms, Rt MIMAT0000087
    49 hsa-miR-30c-5p uguaaacauccuacacucucagc Hu, Ms, Rt MIMAT0000244
    50 hsa-miR-320a aaaagcuggguugagagggcga Hu, Ms, Rt MIMAT0000510
    51 rno-miR-327 ccuugaggggcaugagggu Rt MIMAT0000561
    52 hsa-miR-34a-5p uggcagugucuuagcugguugu Hu, Ms, Rt MIMAT0000255
    53 mmu-miR-34b-5p aggcaguguaauuagcugauugu Ms, Rt MIMAT0000382
    54 hsa-miR-34c-5p aggcaguguaguuagcugauugc Hu, Ms, Rt MIMAT0000686
    55 hsa-mir-370-3p gccugcugggguggaaccuggu Hu, Ms, Rt MIMAT0000722
    56 hsa-miR-375 uuuguucguucggcucgcguga Hu, Ms, Rt MIMAT0000728
    57 hsa-miR-378a-3p acuggacuuggagucagaaggc Hu MIMAT0000732
    58 hsa-miR-410-3p aauauaacacagauggccugu Hu, Ms, Rt MIMAT0002171
    59 hsa-miR-451a aaaccguuaccauuacugaguu Hu, Ms, Rt MIMAT0001631
    60 mmu-miR-503-5p uagcagcgggaacaguacugcag Ms, Rt MIMAT0003188
    61 hsa-miR-652-3p aauggcgccacuaggguugug Hu, Ms, Rt MIMAT0003322
    62 hsa-miR-877-5p guagaggagauggcgcaggg Hu, Ms, Rt MIMAT0004949
    63 hsa-miR-92a-3p uauugcacuugucccggccugu Hu MIMAT0000092
    64 hsa-miR-96-5p uuuggcacuagcacauuuuugcu Hu, Ms, Rt MIMAT0000095
    65 hsa-miR-99a-5p aacccguagauccgaucuugug Hu, Ms, Rt MIMAT0000097
    66 ath-mir167d ugaagcugccagcaugaucugg Ath MIMAT0000905
    67 cel-mir-70-3p uaauacgucguugguguuuccau Cel MIMAT0000042
    68 oan-miR-7417-5p uuccccacucugagcacacagc Oan MIMAT0028982
    69 x-control      
    70 blank      
  • Platform


  • Storage instructions
    Store at +4°C. Please refer to protocols.
  • Components 1 x 48 tests 1 x 96 tests
    FirePlex® Particle Mix (Circulating) 1 x 1750µl 1 x 3500µl


  • Samples of human plasma and sera were run in triplicate on the Circulating Liver Tox Fixed Panel using the Multiplex Circulating miRNA Assay (biofluids). Results were background subtracted and normalized using geometric average, profiling 68 miRNAs per well for each sample.



This product has been referenced in:
  • Hoss AG  et al. miR-10b-5p expression in Huntington's disease brain relates to age of onset and the extent of striatal involvement. BMC Med Genomics 8:10 (2015). Read more (PubMed: 25889241) »
See 1 Publication for this product

Customer reviews and Q&As

There are currently no Customer reviews or Questions for ab218370.
Please use the links above to contact us or submit feedback about this product.

For licensing inquiries, please contact partnerships@abcam.com

Sign up