
  • Product name
    FirePlex® miRNA Panel – Neurology V2
  • Detection method
    Flow cytometry-fluorescent
  • Assay type
  • Assay time
    4h 00m
  • Species reactivity
    Reacts with: Mouse, Rat, Human
  • Product overview

    Multiplex miRNA Assay - Neurology Panel (ab218371) are the FirePlex® particles designed to profile up to 65 literature curated miRNA for neurology studies, miRNAs (see miRNA list) differentially regulated in normal and abnormal neurological or psychiatric health.

    NOTE: FirePlex miRNA panels require the purchase of a Run Buffer. Use our FirePlex Cytometer Setup Kit V2 (ab245835) to select the most appropriate Run Buffer for your flow cytometer.

    Our multiplex miRNA assays use our FirePlex® particle technology to profile up to 65 miRNAs per well. With the same sensitivity as PCR, they can be used either directly with 10 µL of biofluids such as serum or plasma with no need for RNA purification; or with 100 pg of purified RNA.

    Find a full list of validated sample types, and learn more about the performance and requirements of these assays, here.

    These miRNAs have been chosen based on a detailed study of data in peer-reviewed journals and exhibit differential regulation in whole blood, plasma, serum, peripheral blood mononuclear cells (PBMCs) or isolated exosomes.

    Included in the panel are general markers for multiple neurology-related diseases, markers specific to specific nervous system diseases and CNS cancers, markers that may indicate hemolysis contamination in isolated plasma/serum/exosomes and internal controls to validate assay performance.

    It is important to use the normalization procedure in the FirePlex® Analysis Workbench Software to identify the miRNAs that can optimally be used for normalization with your samples. Three miRNAs that are likely to be stably expressed in biofluid samples and may be suitable have been included in this panel.


  • Notes

    To use this product researchers must also purchase the appropriate Core Reagent Kit, either ab218365 for use with purified RNA or ab218342 for use with biofluids. 

    FirePlex® is a registered trade mark in the United States and is an unregistered trade mark elsewhere. 

    ** Hu = Human, Ms = Mouse, Rt = Rat, Ath = Arabidopsis thaliana, Oan = Ornithorhynchus anatinus, Cel = Caenorhabditis elegans. 

    # miRNA 21 name miRNA Sequence (miRBase V21) Sequence homology ** MIMAT ID
    1 hsa-let-7b-5p ugagguaguagguugugugguu Hu, Ms, Rt MIMAT0000063
    2 hsa-let-7d-5p agagguaguagguugcauaguu Hu, Ms, Rt MIMAT0000065
    3 hsa-let-7f-5p ugagguaguagauuguauaguu Hu, Ms, Rt MIMAT0000067
    4 hsa-let-7g-5p ugagguaguaguuuguacaguu Hu, Ms, Rt MIMAT0000414
    5 hsa-let-7i-5p ugagguaguaguuugugcuguu Hu, Ms, Rt MIMAT0000415
    6 ath-mir167d ugaagcugccagcaugaucugg Ath MIMAT0000905
    7 hsa-miR-103a-3p agcagcauuguacagggcuauga Hu, Ms, Rt MIMAT0000101
    8 hsa-miR-107 agcagcauuguacagggcuauca Hu, Ms, Rt MIMAT0000104
    9 hsa-miR-124-3p uaaggcacgcggugaaugcc Hu, Ms, Rt MIMAT0000422
    10 hsa-miR-125b-5p ucccugagacccuaacuuguga Hu, Ms, Rt MIMAT0000423
    11 hsa-miR-128-3p ucacagugaaccggucucuuu Hu, Ms, Rt MIMAT0000424
    12 hsa-miR-1285-5p gaucucacuuuguugcccagg Hu MIMAT0022719
    13 hsa-miR-132-3p uaacagucuacagccauggucg Hu, Ms, Rt MIMAT0000426
    14 hsa-miR-134-5p ugugacugguugaccagagggg Hu, Ms, Rt MIMAT0000447
    15 hsa-miR-142-3p uguaguguuuccuacuuuaugga Hu, Ms, Rt MIMAT0000434
    16 hsa-miR-145-5p guccaguuuucccaggaaucccu Hu, Ms, Rt MIMAT0000437
    17 hsa-miR-146a-5p ugagaacugaauuccauggguu Hu, Ms, Rt MIMAT0000449
    18 hsa-miR-150-5p ucucccaacccuuguaccagug Hu, Ms, Rt MIMAT0000451
    19 hsa-miR-151a-3p cuagacugaagcuccuugagg Hu MIMAT0000757
    20 hsa-miR-155-5p uuaaugcuaaucgugauaggggu Hu MIMAT0000646
    21 hsa-miR-15a-5p uagcagcacauaaugguuugug Hu, Ms MIMAT0000068
    22 hsa-miR-15b-3p cgaaucauuauuugcugcucua Hu, Ms, Rt MIMAT0004586
    23 hsa-miR-15b-5p uagcagcacaucaugguuuaca Hu, Ms, Rt MIMAT0000417
    24 hsa-miR-16-2-3p ccaauauuacugugcugcuuua Hu MIMAT0004518
    25 hsa-miR-16-5p uagcagcacguaaauauuggcg Hu, Ms, Rt MIMAT0000069
    26 hsa-miR-17-5p caaagugcuuacagugcagguag Hu, Ms, Rt MIMAT0000070
    27 hsa-miR-181b-5p aacauucauugcugucggugggu Hu, Ms, Rt MIMAT0000257
    28 cel-mir-70-3p uaauacgucguugguguuuccau Cel MIMAT0000042
    29 hsa-miR-191-5p caacggaaucccaaaagcagcug Hu, Ms, Rt MIMAT0000440
    30 hsa-miR-195-5p uagcagcacagaaauauuggc Hu, Ms, Rt MIMAT0000461
    31 hsa-miR-197-3p uucaccaccuucuccacccagc Hu MIMAT0000227
    32 hsa-miR-206 uggaauguaaggaagugugugg Hu, Ms, Rt MIMAT0000462
    33 hsa-miR-20a-5p uaaagugcuuauagugcagguag Hu, Ms, Rt MIMAT0000075
    34 hsa-miR-210-3p cugugcgugugacagcggcuga Hu, Ms, Rt MIMAT0000267
    35 hsa-miR-214-3p acagcaggcacagacaggcagu Hu, Ms MIMAT0000271
    36 hsa-miR-21-5p uagcuuaucagacugauguuga Hu, Ms, Rt MIMAT0000076
    37 hsa-miR-22-3p aagcugccaguugaagaacugu Hu, Ms, Rt MIMAT0000077
    38 hsa-miR-23a-3p aucacauugccagggauuucc Hu, Ms, Rt MIMAT0000078
    39 hsa-miR-24-3p uggcucaguucagcaggaacag Hu, Ms, Rt MIMAT0000080
    40 hsa-miR-26b-5p uucaaguaauucaggauaggu Hu, Ms, Rt MIMAT0000083
    41 hsa-miR-29b-3p uagcaccauuugaaaucaguguu Hu, Ms, Rt MIMAT0000100
    42 hsa-miR-301a-3p cagugcaauaguauugucaaagc Hu, Ms, Rt MIMAT0000688
    43 hsa-miR-30e-5p uguaaacauccuugacuggaag Hu, Ms, Rt MIMAT0000692
    44 hsa-miR-323a-3p cacauuacacggucgaccucu Hu, Ms, Rt MIMAT0000755
    45 hsa-miR-328-3p cuggcccucucugcccuuccgu Hu, Ms, Rt MIMAT0000752
    46 hsa-miR-331-5p cuagguauggucccagggaucc Hu, Ms MIMAT0004700
    47 hsa-miR-338-3p uccagcaucagugauuuuguug Hu, Ms MIMAT0000763
    48 hsa-miR-342-3p ucucacacagaaaucgcacccgu Hu, Ms, Rt MIMAT0000753
    49 hsa-miR-346 ugucugcccgcaugccugccucu Hu MIMAT0000773
    50 hsa-miR-34a-5p uggcagugucuuagcugguugu Hu, Ms, Rt MIMAT0000255
    51 hsa-miR-34b-3p caaucacuaacuccacugccau Hu MIMAT0004676
    52 hsa-miR-34c-5p aggcaguguaguuagcugauugc Hu, Ms, Rt MIMAT0000686
    53 hsa-miR-370-3p gccugcugggguggaaccuggu Hu, Ms, Rt MIMAT0000722
    54 hsa-miR-382-5p gaaguuguucgugguggauucg Hu, Ms, Rt MIMAT0000737
    55 hsa-miR-451a aaaccguuaccauuacugaguu Hu, Ms, Rt MIMAT0001631
    56 hsa-miR-483-3p ucacuccucuccucccgucuu Hu MIMAT0002173
    57 hsa-miR-486-5p uccuguacugagcugccccgag Hu, Ms, Rt MIMAT0002177
    58 hsa-miR-491-5p aguggggaacccuuccaugagg Hu, Ms MIMAT0002807
    59 hsa-miR-497-5p cagcagcacacugugguuugu Hu MIMAT0002820
    60 hsa-miR-5010-3p uuuugugucucccauuccccag Hu MIMAT0021044
    61 hsa-miR-532-5p caugccuugaguguaggaccgu Hu, Ms MIMAT0002888
    62 hsa-miR-545-3p ucagcaaacauuuauugugugc Hu, Ms, Rt MIMAT0003165
    63 hsa-miR-7-5p uggaagacuagugauuuuguugu Hu, Ms, Rt MIMAT0000252
    64 oan-miR-7417-5p uuccccacucugagcacacagc Oan MIMAT0028982
    65 hsa-miR-885-5p uccauuacacuacccugccucu Hu MIMAT0004947
    66 hsa-miR-92a-1-5p agguugggaucgguugcaaugcu Hu MIMAT0004507
    67 hsa-miR-93-5p caaagugcuguucgugcagguag Hu, Ms, Rt MIMAT0000093
    68 hsa-miR-98-5p ugagguaguaaguuguauuguu Hu, Ms, Rt MIMAT0000096
    69 x-control x-control N/A  
    70 blank blank N/A  




  • Platform


  • Storage instructions
    Store at +4°C. Please refer to protocols.
  • Components 1 x 48 tests 1 x 96 tests
    FirePlex® Particle Mix (Circulating) 1 x 1750µl 1 x 3500µl


  • Samples of human plasma and sera were run in triplicate on the Circulating Neurology Fixed Panel using the Multiplex Circulating miRNA Assay (biofluids). Results were background subtracted and normalized using geometric average, profiling 68 miRNAs per well for each sample.



This product has been referenced in:
  • Hoss AG  et al. miR-10b-5p expression in Huntington's disease brain relates to age of onset and the extent of striatal involvement. BMC Med Genomics 8:10 (2015). Read more (PubMed: 25889241) »
See 1 Publication for this product

Customer reviews and Q&As

There are currently no Customer reviews or Questions for ab218371.
Please use the links above to contact us or submit feedback about this product.


Sign up