For the best experience on the Abcam website please upgrade to a modern browser such as Google Chrome

Hello. We're improving abcam.com and we'd welcome your feedback.

Hello. We're improving abcam.com and we'd welcome your feedback.

Infomation icon

We haven't added this to the BETA yet

New BETA website

New BETA website

Hello. We're improving abcam.com and we'd welcome your feedback.

Take a look at our BETA site and see what we’ve done so far.

Switch on our new BETA site

Now available

Search and browse selected products

  • A selection of primary antibodies

Purchase these through your usual distributor

In the coming months

  • Additional product types
  • Supporting content
  • Sign in to your account
  • Purchase online
United States
Your country/region is currently set to:

If incorrect, please enter your country/region into the box below, to view site information related to your country/region.

Call (888) 77-ABCAM (22226) or contact us
Need help? Contact us

  • My account
  • Sign out
Sign in or Register with us

Welcome

Sign in or

Don't have an account?

Register with us
My basket
Quick order
Abcam homepage

  • Research Products
    By product type
    Primary antibodies
    Secondary antibodies
    ELISA and Matched Antibody Pair Kits
    Cell and tissue imaging tools
    Cellular and biochemical assays
    Proteins and Peptides
    By product type
    Proteomics tools
    Agonists, activators, antagonists and inhibitors
    Cell lines and Lysates
    Multiplex miRNA assays
    Multiplex Assays
    By research area
    Cancer
    Cardiovascular
    Cell Biology
    Epigenetics
    Metabolism
    Developmental Biology
    By research area
    Immunology
    Microbiology
    Neuroscience
    Signal Transduction
    Stem Cells
  • Customized Products & Partnerships
    Customized Products & Partnerships

    Customized products and commercial partnerships to accelerate your diagnostic and therapeutic programs.

    Customized products

    Partner with us

  • Support
    Support hub

    Access advice and support for any research roadblock

    View support hub

    Protocols

    Your experiments laid out step by step

    View protocols

  • Events
    • Conference calendar
    • Cancer
    • Cardiovascular
    • Epigenetics & Nuclear signaling
    • Immunology
    • Neuroscience
    • Stem cells
    • Tradeshows
    • Scientific webinars
    Keep up to date with the latest events

    Full event breakdown with abstracts, speakers, registration and more

    View global event calendar

  • Pathways
    Cell signalling pathways

    View all pathways

    View all interactive pathways

Explore the power of knock-out cell lines for your research

  1. Link

    kmt1a--suv39h1-antibody-441-ab12405.pdf

  1. Send me a copy of this email
    I agree to the terms and conditions.
Epigenetics and Nuclear Signaling Chromatin Modifying Enzymes Methylation
Share by email

Anti-KMT1A / SUV39H1 antibody [44.1] (ab12405)

  • Datasheet
  • SDS
Reviews (3)Q&A (3)References (31)

Product price, shipping and contact information

Currently unavailable

Sorry, we can't display this right now.

Please contact us to place your order, or try again later.

 

Loading size & price…

 

Shipping and order information

Shipping info

Promotion Information

Abpromise

Guaranteed product quality, expert customer support.

Find out more.

Western blot - Anti-KMT1A / SUV39H1 antibody [44.1] (ab12405)

    Key features and details

    • Mouse monoclonal [44.1] to KMT1A / SUV39H1
    • Suitable for: WB
    • Reacts with: Human
    • Isotype: IgG1

    You may also be interested in

    Secondary
    Product image
    Goat Anti-Mouse IgG H&L (HRP) (ab205719)
    Primary
    Product image
    Anti-IRG1 antibody (ab222417)
    Assay
    Product image
    NAD/NADH Assay Kit (Colorimetric) (ab65348)

    View more associated products

    Overview

    • Product name

      Anti-KMT1A / SUV39H1 antibody [44.1]
      See all KMT1A / SUV39H1 primary antibodies
    • Description

      Mouse monoclonal [44.1] to KMT1A / SUV39H1
    • Host species

      Mouse
    • Tested applications

      Suitable for: WBmore details
    • Species reactivity

      Reacts with: Human
      Predicted to work with: Mouse, Rat
    • Immunogen

      Recombinant fragment. This information is proprietary to Abcam and/or its suppliers.

    • Epitope

      ab12405 recognizes an epitope in the N-terminal (195 amino acids) of human KMT1A / SUV39H1.
    • Positive control

      • HCT116, U87-MG and TE671 cell lysates.
    • General notes

      Storage in frost-free freezers is also not recommended. If slight turbidity occurs upon prolonged storage, clarify the solution by centrifugation before use.

      This antibody clone is manufactured by Abcam. If you require a custom buffer formulation or conjugation for your experiments, please contact orders@abcam.com.

      The Life Science industry has been in the grips of a reproducibility crisis for a number of years. Abcam is leading the way in addressing this with our range of recombinant monoclonal antibodies and knockout edited cell lines for gold-standard validation. Please check that this product meets your needs before purchasing.

      If you have any questions, special requirements or concerns, please send us an inquiry and/or contact our Support team ahead of purchase. Recommended alternatives for this product can be found below, along with publications, customer reviews and Q&As

    Properties

    • Form

      Liquid
    • Storage instructions

      Shipped at 4°C. Store at +4°C short term (1-2 weeks). Upon delivery aliquot. Store at -20°C. Avoid freeze / thaw cycle.
    • Storage buffer

      pH: 7.40
      Preservative: 0.02% Sodium azide
      Constituents: PBS, 6.97% L-Arginine
    • Concentration information loading...
    • Purity

      Protein G purified
    • Clonality

      Monoclonal
    • Clone number

      44.1
    • Isotype

      IgG1
    • Research areas

      • Epigenetics and Nuclear Signaling
      • Chromatin Modifying Enzymes
      • Methylation
      • Microbiology
      • Interspecies Interaction
      • Host Virus Interaction
      • Epigenetics and Nuclear Signaling
      • Chromatin Modifying Enzymes
      • Methylation
      • Lysine methylation
      • Cancer
      • Cell cycle
      • Cell cycle inhibitors
      • Rb

    Associated products

    • ChIP Related Products

      • Rabbit Anti-Mouse IgG H&L (ab46540)
      • ChIP Kit (ab500)
    • Compatible Secondaries

      • Goat Anti-Mouse IgG H&L (Alexa Fluor® 488) (ab150113)
      • Goat Anti-Mouse IgG H&L (HRP) (ab205719)
    • Isotype control

      • Mouse IgG1, kappa monoclonal [15-6E10A7] - Isotype Control (ab170190)
    • Recombinant Protein

      • Recombinant human KMT1A / SUV39H1 protein (ab80289)

    Applications

    The Abpromise guarantee

    Our Abpromise guarantee covers the use of ab12405 in the following tested applications.

    The application notes include recommended starting dilutions; optimal dilutions/concentrations should be determined by the end user.

    Application Abreviews Notes
    WB (1)
    Use a concentration of 1 - 5 µg/ml. Predicted molecular weight: 48 kDa.

    The target may be expressed at low levels and we would recommend a highly enriched nuclear extract as a sample for WB. Additionally, a signal amplification step using a biotin conjugate as a secondary antibody is preferrable over the enzyme conjugated secondary antibody method.

    Notes
    WB
    Use a concentration of 1 - 5 µg/ml. Predicted molecular weight: 48 kDa.

    The target may be expressed at low levels and we would recommend a highly enriched nuclear extract as a sample for WB. Additionally, a signal amplification step using a biotin conjugate as a secondary antibody is preferrable over the enzyme conjugated secondary antibody method.

    Target

    • Function

      Histone methyltransferase that specifically trimethylates 'Lys-9' of histone H3 using monomethylated H3 'Lys-9' as substrate. Also weakly methylates histone H1 (in vitro). H3 'Lys-9' trimethylation represents a specific tag for epigenetic transcriptional repression by recruiting HP1 (CBX1, CBX3 and/or CBX5) proteins to methylated histones. Mainly functions in heterochromatin regions, thereby playing a central role in the establishment of constitutive heterochromatin at pericentric and telomere regions. H3 'Lys-9' trimethylation is also required to direct DNA methylation at pericentric repeats. SUV39H1 is targeted to histone H3 via its interaction with RB1 and is involved in many processes, such as repression of MYOD1-stimulated differentiation, regulation of the control switch for exiting the cell cycle and entering differentiation, repression by the PML-RARA fusion protein, BMP-induced repression, repression of switch recombination to IgA and regulation of telomere length. Component of the eNoSC (energy-dependent nucleolar silencing) complex, a complex that mediates silencing of rDNA in response to intracellular energy status and acts by recruiting histone-modifying enzymes. The eNoSC complex is able to sense the energy status of cell: upon glucose starvation, elevation of NAD(+)/NADP(+) ratio activates SIRT1, leading to histone H3 deacetylation followed by dimethylation of H3 at 'Lys-9' (H3K9me2) by SUV39H1 and the formation of silent chromatin in the rDNA locus. Recruited by the large PER complex to the E-box elements of the circadian target genes such as PER2 itself or PER1, contributes to the conversion of local chromatin to a heterochromatin-like repressive state through H3 'Lys-9' trimethylation.
    • Sequence similarities

      Belongs to the class V-like SAM-binding methyltransferase superfamily. Histone-lysine methyltransferase family. Suvar3-9 subfamily.
      Contains 1 chromo domain.
      Contains 1 post-SET domain.
      Contains 1 pre-SET domain.
      Contains 1 SET domain.
    • Developmental stage

      Accumulates during mitosis at centromeres during prometaphase, but dissociates from the centromere at the meta- to anaphase transition.
    • Domain

      Although the SET domain contains the active site of enzymatic activity, both pre-SET and post-SET domains are required for methyltransferase activity. The SET domain also participates to stable binding to heterochromatin.
      In the pre-SET domain, Cys residues bind 3 zinc ions that are arranged in a triangular cluster; some of these Cys residues contribute to the binding of two zinc ions within the cluster.
    • Post-translational
      modifications

      Phosphorylated on serine residues, and to a lesser degree, on threonine residues. The phosphorylated form is stabilized by SBF1 and is less active in its transcriptional repressor function.
      Acetylated at Lys-266, leading to inhibition of enzyme activity. SIRT1-mediated deacetylation relieves this inhibition.
    • Cellular localization

      Nucleus. Nucleus lamina. Nucleus, nucleoplasm. Chromosome, centromere. Associates with centromeric constitutive heterochromatin.
    • Target information above from: UniProt accession O43463 The UniProt Consortium
      The Universal Protein Resource (UniProt) in 2010
      Nucleic Acids Res. 38:D142-D148 (2010) .

      Information by UniProt
    • Database links

      • Entrez Gene: 6839 Human
      • Entrez Gene: 20937 Mouse
      • Entrez Gene: 302553 Rat
      • Omim: 300254 Human
      • SwissProt: O43463 Human
      • SwissProt: O54864 Mouse
      • Unigene: 522639 Human
      • Unigene: 479743 Mouse
      • Unigene: 9244 Mouse
      see all
    • Alternative names

      • H3 K9 HMTase1 antibody
      • H3-K9-HMTase 1 antibody
      • Histone H3-K9 methyltransferase 1 antibody
      • Histone H3-K9 methyltransferase1 antibody
      • Histone lysine N methyltransferase, H3 lysine 9 specific 1 antibody
      • Histone-lysine N-methyltransferase SUV39H1 antibody
      • KMT1 A antibody
      • KMT1A antibody
      • Lysine N methyltransferase 1A antibody
      • Lysine N-methyltransferase 1A antibody
      • MG44 antibody
      • mIS6 antibody
      • Position-effect variegation 3-9 homolog antibody
      • Su(var)3 9 homolog 1 antibody
      • Su(var)3-9 homolog 1 antibody
      • Suppressor of variegation 3 9 homolog 1 (Drosophila) antibody
      • Suppressor of variegation 3-9 homolog 1 antibody
      • SUV39 H1 antibody
      • SUV39H antibody
      • SUV39H1 antibody
      • SUV91_HUMAN antibody
      see all

    Images

    • Western blot - Anti-KMT1A / SUV39H1 antibody [44.1] (ab12405)
      Western blot - Anti-KMT1A / SUV39H1 antibody [44.1] (ab12405)
      All lanes : Anti-KMT1A / SUV39H1 antibody [44.1] (ab12405) at 5 µg

      Lane 1 : HCT 116 (Human Colorectal Carcinoma) Whole Cell Lysate
      Lane 2 : U-87 MG (Human glioblastoma astrocytoma) Whole Cell Lysate
      Lane 3 : TE 671 (Human Rhabdomyosarcoma) Whole Cell Lysate

      Lysates/proteins at 20 µg per lane.

      Secondary
      All lanes : Goat polyclonal to Mouse IgG - H&L - Pre-Adsorbed (HRP) (ab65485) at 1/5000 dilution

      Developed using the ECL technique.

      Performed under reducing conditions.

      Predicted band size: 48 kDa
      Observed band size: 60 kDa why is the actual band size different from the predicted?
      Additional bands at: 36 kDa. We are unsure as to the identity of these extra bands.


      Exposure time: 4 minutes


      This blot was produced using a 4-12% Bis-tris gel under the MOPS buffer system. The gel was run at 200V for 50 minutes before being transferred onto a Nitrocellulose membrane at 30V for 70 minutes. The membrane was then blocked for an hour using 2% Bovine Serum Albumin before being incubated with ab12405 overnight at 4°C. Antibody binding was detected using an anti-rabbit antibody conjugated to HRP, and visualised using ECL development solution ab133406

    Protocols

    • ChIP protocol (Marban et al Methods)

    Click here to view the general protocols

    Datasheets and documents

    • SDS download

    • Datasheet download

      Download

    References (31)

    Publishing research using ab12405? Please let us know so that we can cite the reference in this datasheet.

    ab12405 has been referenced in 31 publications.

    • Zhou C  et al. FGF8 and BMP2 mediated dynamic regulation of dental mesenchyme proliferation and differentiation via Lhx8/Suv39h1 complex. J Cell Mol Med 25:3051-3062 (2021). PubMed: 33580754
    • Scarola M  et al. FUS-dependent loading of SUV39H1 to OCT4 pseudogene-lncRNA programs a silencing complex with OCT4 promoter specificity. Commun Biol 3:632 (2020). PubMed: 33128015
    • Luo Y  et al. CD74 knockout protects against LPS-induced myocardial contractile dysfunction through AMPK-Skp2-SUV39H1-mediated demethylation of BCLB. Br J Pharmacol 177:1881-1897 (2020). PubMed: 31877229
    • Yi SA  et al. HP1? Sensitizes Cervical Cancer Cells to Cisplatin through the Suppression of UBE2L3. Int J Mol Sci 21:N/A (2020). PubMed: 32825184
    • Zhang J  et al. Down-regulation of Suv39h1 attenuates neointima formation after carotid artery injury in diabetic rats. J Cell Mol Med 24:973-983 (2020). PubMed: 31736204
    View all Publications for this product

    Customer reviews and Q&As

    Show All Reviews Q&A
    Submit a review Submit a question

    1-6 of 6 Abreviews or Q&A

    Immunocytochemistry/ Immunofluorescence abreview for Anti-KMT1A / SUV39H1 antibody [44.1] - ChIP Grade

    Poor
    Abreviews
    Abreviews
    abreview image
    Application
    Immunocytochemistry/ Immunofluorescence
    Sample
    Human Cell (HeLa)
    Permeabilization
    Yes - 0.5% Triton-X100 in PBS
    Specification
    HeLa
    Fixative
    Paraformaldehyde
    Read More
    The reviewer received a reward from Abcam’s Loyalty Program in thanks for submitting this Abreview and for helping the scientific community make better-informed decisions.

    DR. Kirk Mcmanus

    Verified customer

    Submitted Aug 22 2014

    ChIP abreview for Anti-KMT1A / SUV39H1 antibody [44.1] - ChIP Grade

    Good
    Abreviews
    Abreviews
    abreview image
    Application
    ChIP
    Sample
    Rat Cell lysate - nuclear (hepatic stellate cell chromatin)
    Specification
    hepatic stellate cell chromatin
    Type
    Cross-linking (X-ChIP)
    Duration of cross-linking step: 0 second(s)
    Specification of the cross-linking agent: formaldehyde (1% final conc)
    Detection step
    Semiquantitative PCR
    Negative control
    Isotype matched irrelevant antibody
    Read More
    The reviewer received a reward from Abcam’s Loyalty Program in thanks for submitting this Abreview and for helping the scientific community make better-informed decisions.

    DR. Jelena Mann

    Verified customer

    Submitted May 01 2007

    Western blot abreview for Anti-KMT1A / SUV39H1 antibody [44.1] - ChIP Grade

    Poor
    Abreviews
    Abreviews
    Application
    Western blot
    Sample
    Mouse Cell lysate - whole cell (3T3 cells)
    Loading amount
    200000 cells
    Specification
    3T3 cells
    Blocking step
    Milk as blocking agent for 1 hour(s) and 0 minute(s) · Concentration: 5%
    Read More
    The reviewer received a reward from Abcam’s Loyalty Program in thanks for submitting this Abreview and for helping the scientific community make better-informed decisions.

    Abcam user community

    Verified customer

    Submitted Dec 27 2006

    Question

    Hi, I have a question regarding your anti-SUV39h1 antibody. In your data sheet, the ChIP assy figure demonstrated that you are able to precipitate more DNA from the heterochromatin region. However, I can't find a reference or definition to the "SAT2" or "SATa" that you are refering to. Could you me give a reference regarding the sequence of the primers and probes you've used for the quantitative PCR. Thank you very much.

    Read More

    Abcam community

    Verified customer

    Asked on Sep 28 2005

    Answer

    Thank you for your enquiry. This antibody was tested for its capacity to immunoprecipitate chromatin here at Abcam. Our laboratory team were responsible for the design and execution of the experiments. I have been in touch with them and the definitions and primer sequences for the SAT regions are as follows. "SAT2" - Accession number X72623 Chr1 hSat2 repeat - F ATCGAATGGAAATGAAAGGAGTCA Chr1 hSat2 repeat - R GACCATTGGATGATTGCAGTCA "SATa" - Accession number M26919 Chr1 hSat alpha - F AAGGTCAATGGCAGAAAAGAA Chr1 hSat alpha - R CAACGAAGGCCACAAGATGTC I hope that this information helps. Please do not hesitate to contact me should you require further assistance.

    Read More

    Abcam Scientific Support

    Answered on Sep 29 2005

    Question

    BATCH NUMBER 74959 ORDER NUMBER 61329 DESCRIPTION OF THE PROBLEM No signal at all SAMPLE mouse cultured cells PRIMARY ANTIBODY ab12405 1:100 SECONDARY ANTIBODY donkey anti mouse Cy3 (Jackson Lab) DETECTION METHOD Immunofluorescent microscopy POSITIVE AND NEGATIVE CONTROLS USED negative control: normal mouse IgG instead of ab12405 No positive control (the staining with ab8898 in the same experiment worked) ANTIBODY STORAGE CONDITIONS 4 degree (centigrade) FIXATION OF SAMPLE 4% PFA for 10 min ANTIGEN RETRIEVAL none PERMEABILIZATION STEP 0.1% Triton in preblocking buffer BLOCKING CONDITIONS 0.3% donkey serum in TBS+0.1% Triton X100 HOW MANY TIMES HAVE YOU TRIED THE APPLICATION? 2 HAVE YOU RUN A "NO PRIMARY" CONTROL? Yes DO YOU OBTAIN THE SAME RESULTS EVERY TIME? Yes WHAT STEPS HAVE YOU ALTERED? use 1:100 dilution of ab12405 instead of 1:500 dilution ADDITIONAL NOTES We routinely doing staining on cells. This ab12405 did not work at all in all our staining,while other antibodies worked in the same experiments. ab12405 also did not work for western blotting.

    Read More

    Abcam community

    Verified customer

    Asked on Jan 12 2005

    Answer

    I would like to recommend trying a fixation with ice cold methanol or acetone for 10min and adding triton x100 (0.1%) in the dilution buffer of both primary and secondary antibodies. If you still have problems with this antibody in ICC and WB please let me know and I will arrange for a replacement antibody to be sent to you,

    Read More

    Abcam Scientific Support

    Answered on Jan 13 2005

    Question

    BATCH NUMBER 74959 ORDER NUMBER 61329 DESCRIPTION OF THE PROBLEM no bands at all SAMPLE mouse, cultured cell extract and total brain lysate PRIMARY ANTIBODY ab12405 1:300 in TBST+ 1% BSA SECONDARY ANTIBODY anti-Mouse HRP (Perkin Elmer) DETECTION METHOD ECLplus POSITIVE AND NEGATIVE CONTROLS USED none ANTIBODY STORAGE CONDITIONS 4 degree (centigrade) SAMPLE PREPARATION RIPA buffer 20mM Tris, pH 8, 150mM NaCL. 1% Triton x100, 1mM DTT, freshed added 1 tablet/10ml protease inhibitor cocktail (Roche) AMOUNT OF PROTEIN LOADED 50 ug ELECTROPHORESIS/GEL CONDITIONS Tris-Glycine getl 15%, loading dye has b-ME for reduction TRANSFER AND BLOCKING CONDITIONS Standard Tris-Glycine 10% Methanol transfer buffer Blcok with 5% non-fat milk in TBST HOW MANY TIMES HAVE YOU TRIED THE APPLICATION? 3 HAVE YOU RUN A "NO PRIMARY" CONTROL? No DO YOU OBTAIN THE SAME RESULTS EVERY TIME? Yes WHAT STEPS HAVE YOU ALTERED? increase protein loaded from 30 ug to 50 ug ADDITIONAL NOTES I made correction of lot number here I did western blot with ab8898 at the same time and it worked but ab 12405 did not work ab12405 also did not work for immuno staining

    Read More

    Abcam community

    Verified customer

    Asked on Jan 12 2005

    Answer

    I'm sorry to hear you are having problems with ab12405 both in WB and in IHC. For the WB problem, I would like to suggest using a nuclear extract of your cells rather than a whole cell extract as the protein is nuclear. You did not mention the incubation time with the primary antibody, please make sure you incubate overnight at 4C. We have a protocol for histone western blotting that you may want to take a look at, I enclose it here: is protocol refers to western blot detection of Histone proteins derived from purified calf thymus. Please note that protein loadings derived from cellular lysates will need to be determined empirically. For each gel lane between 1-2 mg of total Histone protein solution in 1x sample buffer should prove sufficient. The choice of sample buffer will vary depending on the type of gel used (i.e. Tris / glycine or Tris / Tricine SDS PAGE). N.B. A higher percentage gel such as 10-20% Tricine SDS-polyacrylamide is recommended for effective resolution of Histone proteins The sample should be supplemented with 5% (v/v) b-mercaptoethanol and heated to around 95°C for 5 min. The sample should be centrifuged briefly to restore sample volume from condensation formation in the eppendorf during heating. Load the protein samples onto the appropriate SDS-polyacrylamide gel and run the gel under standard conditions. NB it is advisable not to run the dye front completely off the gel when dealing with smaller protein resolutions. For protein transfer from the gel please refer to the protocols supplied with your transfer apparatus, as these will vary depending upon the method of transfer employed i.e. semi-dry blotting or wet blotting. N.B. Nitrocellulose membranes with a pore size of 0.2 mm are recommended for optimal retention of Histone proteins. Transfer times between 30 min and 90 min should prove sufficient for effective protein transfer. Visualise equivalent protein loadings using Ponceau staining Block the membranes by adding an appreciable volume of blocking buffer (5% (w/v) BSA, 0.5% (v/v) Tween-20 in TBS or PBS as preferred). Incubate for 1 h at room temperature by gentle rotation. Dilute the primary antibody in blocking buffer as suggested in the datasheet protocols and incubate the blots overnight at 4°C with gentle rotation. N.B. If you wish to perform blocking peptide studies then a final concentration of between 0.1 and 1.0 mg/ml peptide should be pre-incubated with the antibody for around 20 min at room temperature before the blots are added. Rinse the blots briefly in PBS or TBS then perform two 5 min washes in blocking buffer. Prepare the relevant secondary antibody conjugate in blocking buffer and incubate the blots for 1 h at room temperature with gentle rotation. Wash the blots with three 5 min washes in blocking buffer and then perform a final rinse in PBS or TBS. Perform ECL, ECF or infrared detection as described by the manufacturer. Top Tips for Successful Western blotting with our range of Histone antibodies. · Use a high percentage gel for clear resolution of Histone proteins. · Use nitrocellulose membrane with a pore size of 0.2 mm to ensure optimal capture of Histone proteins. · Use high quality BSA in your blocking solutions rather than conventional dried milk such as Marvel. We also recommend HeLa nuclear extract as a positive control, you may wish to try this in parallel. If you still have a problem do not hesitate to contact us again,

    Read More

    Abcam Scientific Support

    Answered on Jan 13 2005

    Please note: All products are "FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES"
    For licensing inquiries, please contact partnerships@abcam.com

    Get resources and offers direct to your inbox Sign up
    A-Z by research area
    • Cancer
    • Cardiovascular
    • Cell biology
    • Developmental biology
    • Epigenetics & Nuclear signaling
    • Immunology
    • Metabolism
    • Microbiology
    • Neuroscience
    • Signal transduction
    • Stem cells
    A-Z by product type
    • Primary antibodies
    • Secondary antibodies
    • Biochemicals
    • Isotype controls
    • Flow cytometry multi-color selector
    • Kits
    • Loading controls
    • Lysates
    • Peptides
    • Proteins
    • Slides
    • Tags and cell markers
    • Tools & Reagents
    Help & support
    • Support
    • Make an Inquiry
    • Protocols & troubleshooting
    • Placing an order
    • RabMAb products
    • Biochemical product FAQs
    • Training
    • Browse by Target
    Company
    • Corporate site
    • Investor relations
    • Company news
    • Careers
    • About us
    • Blog
    Events
    • Tradeshows
    • Conferences
    International websites
    • abcam.cn
    • abcam.co.jp

    Join with us

    • LinkedIn
    • facebook
    • Twitter
    • YouTube
    • Terms of sale
    • Website terms of use
    • Cookie policy
    • Privacy policy
    • Legal
    • Modern slavery statement
    © 1998-2022 Abcam plc. All rights reserved.