Overview

  • Product name
    Anti-KMT1A / SUV39H1 antibody [44.1] - ChIP Grade
    See all KMT1A / SUV39H1 primary antibodies
  • Description
    Mouse monoclonal [44.1] to KMT1A / SUV39H1 - ChIP Grade
  • Host species
    Mouse
  • Tested applications
    Suitable for: ChIP, ELISA, IP, WBmore details
  • Species reactivity
    Reacts with: Mouse, Rat, Human
  • Immunogen

    Recombinant fusion protein, MBP-SUV39H1.

  • Epitope
    Ab 12405 recognizes an epitope in the N-terminal (195 amino acids) of human and mouse SUV39H1 Histone Methyltransferase.
  • Positive control
    • HCT116, U87-MG and TE671 cell lysates.
  • General notes

    This antibody clone is manufactured by Abcam.

    Storage in frost-free freezers is also not recommended. If slight turbidity occurs upon prolonged storage, clarify the solution by centrifugation before use.

    If you require this antibody in a particular buffer formulation or a particular conjugate for your experiments, please contact orders@abcam.com or you can find further information here.

Properties

Applications

Our Abpromise guarantee covers the use of ab12405 in the following tested applications.

The application notes include recommended starting dilutions; optimal dilutions/concentrations should be determined by the end user.

Application Abreviews Notes
ChIP Use at an assay dependent concentration. PubMed: 26028027
ELISA Use at an assay dependent concentration.
IP Use at an assay dependent concentration.
WB Use a concentration of 1 - 5 µg/ml. Predicted molecular weight: 48 kDa.

The target may be expressed at low levels and we would recommend a highly enriched nuclear extract as a sample for WB. Additionally, a signal amplification step using a biotin conjugate as a secondary antibody is preferrable over the enzyme conjugated secondary antibody method.

Target

  • Function
    Histone methyltransferase that specifically trimethylates 'Lys-9' of histone H3 using monomethylated H3 'Lys-9' as substrate. Also weakly methylates histone H1 (in vitro). H3 'Lys-9' trimethylation represents a specific tag for epigenetic transcriptional repression by recruiting HP1 (CBX1, CBX3 and/or CBX5) proteins to methylated histones. Mainly functions in heterochromatin regions, thereby playing a central role in the establishment of constitutive heterochromatin at pericentric and telomere regions. H3 'Lys-9' trimethylation is also required to direct DNA methylation at pericentric repeats. SUV39H1 is targeted to histone H3 via its interaction with RB1 and is involved in many processes, such as repression of MYOD1-stimulated differentiation, regulation of the control switch for exiting the cell cycle and entering differentiation, repression by the PML-RARA fusion protein, BMP-induced repression, repression of switch recombination to IgA and regulation of telomere length. Component of the eNoSC (energy-dependent nucleolar silencing) complex, a complex that mediates silencing of rDNA in response to intracellular energy status and acts by recruiting histone-modifying enzymes. The eNoSC complex is able to sense the energy status of cell: upon glucose starvation, elevation of NAD(+)/NADP(+) ratio activates SIRT1, leading to histone H3 deacetylation followed by dimethylation of H3 at 'Lys-9' (H3K9me2) by SUV39H1 and the formation of silent chromatin in the rDNA locus. Recruited by the large PER complex to the E-box elements of the circadian target genes such as PER2 itself or PER1, contributes to the conversion of local chromatin to a heterochromatin-like repressive state through H3 'Lys-9' trimethylation.
  • Sequence similarities
    Belongs to the class V-like SAM-binding methyltransferase superfamily. Histone-lysine methyltransferase family. Suvar3-9 subfamily.
    Contains 1 chromo domain.
    Contains 1 post-SET domain.
    Contains 1 pre-SET domain.
    Contains 1 SET domain.
  • Developmental stage
    Accumulates during mitosis at centromeres during prometaphase, but dissociates from the centromere at the meta- to anaphase transition.
  • Domain
    Although the SET domain contains the active site of enzymatic activity, both pre-SET and post-SET domains are required for methyltransferase activity. The SET domain also participates to stable binding to heterochromatin.
    In the pre-SET domain, Cys residues bind 3 zinc ions that are arranged in a triangular cluster; some of these Cys residues contribute to the binding of two zinc ions within the cluster.
  • Post-translational
    modifications
    Phosphorylated on serine residues, and to a lesser degree, on threonine residues. The phosphorylated form is stabilized by SBF1 and is less active in its transcriptional repressor function.
    Acetylated at Lys-266, leading to inhibition of enzyme activity. SIRT1-mediated deacetylation relieves this inhibition.
  • Cellular localization
    Nucleus. Nucleus lamina. Nucleus, nucleoplasm. Chromosome, centromere. Associates with centromeric constitutive heterochromatin.
  • Information by UniProt
  • Database links
  • Alternative names
    • H3 K9 HMTase1 antibody
    • H3-K9-HMTase 1 antibody
    • Histone H3-K9 methyltransferase 1 antibody
    • Histone H3-K9 methyltransferase1 antibody
    • Histone lysine N methyltransferase, H3 lysine 9 specific 1 antibody
    • Histone-lysine N-methyltransferase SUV39H1 antibody
    • KMT1 A antibody
    • KMT1A antibody
    • Lysine N methyltransferase 1A antibody
    • Lysine N-methyltransferase 1A antibody
    • MG44 antibody
    • mIS6 antibody
    • Position-effect variegation 3-9 homolog antibody
    • Su(var)3 9 homolog 1 antibody
    • Su(var)3-9 homolog 1 antibody
    • Suppressor of variegation 3 9 homolog 1 (Drosophila) antibody
    • Suppressor of variegation 3-9 homolog 1 antibody
    • SUV39 H1 antibody
    • SUV39H antibody
    • SUV39H1 antibody
    • SUV91_HUMAN antibody
    see all

Images

  • All lanes : Anti-KMT1A / SUV39H1 antibody [44.1] - ChIP Grade (ab12405) at 5 µg

    Lane 1 : HCT 116 (Human Colorectal Carcinoma) Whole Cell Lysate
    Lane 2 : U-87 MG (Human glioblastoma astrocytoma) Whole Cell Lysate
    Lane 3 : TE 671 (Human Rhabdomyosarcoma) Whole Cell Lysate

    Lysates/proteins at 20 µg per lane.

    Secondary
    All lanes : Goat polyclonal to Mouse IgG - H&L - Pre-Adsorbed (HRP) (ab65485) at 1/5000 dilution

    Developed using the ECL technique.

    Performed under reducing conditions.

    Predicted band size: 48 kDa
    Observed band size: 60 kDa
    why is the actual band size different from the predicted?
    Additional bands at: 36 kDa. We are unsure as to the identity of these extra bands.


    Exposure time: 4 minutes


    This blot was produced using a 4-12% Bis-tris gel under the MOPS buffer system. The gel was run at 200V for 50 minutes before being transferred onto a Nitrocellulose membrane at 30V for 70 minutes. The membrane was then blocked for an hour using 2% Bovine Serum Albumin before being incubated with ab12405 overnight at 4°C. Antibody binding was detected using an anti-rabbit antibody conjugated to HRP, and visualised using ECL development solution ab133406

References

This product has been referenced in:
  • Yang G  et al. The histone H3K9 methyltransferase SUV39H links SIRT1 repression to myocardial infarction. Nat Commun 8:14941 (2017). ChIP . Read more (PubMed: 28361889) »
  • Park SJ  et al. MacroH2A1 downregulation enhances the stem-like properties of bladder cancer cells by transactivation of Lin28B. Oncogene 35:1292-301 (2016). ChIP ; Human . Read more (PubMed: 26028027) »
See all 19 Publications for this product

Customer reviews and Q&As

1-6 of 6 Abreviews or Q&A

Abcam has not validated the combination of species/application used in this Abreview.
Application
Immunocytochemistry/ Immunofluorescence
Sample
Human Cell (HeLa)
Permeabilization
Yes - 0.5% Triton-X100 in PBS
Specification
HeLa
Fixative
Paraformaldehyde

Dr. Kirk Mcmanus

Verified customer

Submitted Aug 22 2014

Abcam guarantees this product to work in the species/application used in this Abreview.
Application
ChIP
Sample
Rat Cell lysate - nuclear (hepatic stellate cell chromatin)
Specification
hepatic stellate cell chromatin
Type
Cross-linking (X-ChIP)
Duration of cross-linking step: 0 second(s)
Specification of the cross-linking agent: formaldehyde (1% final conc)
Detection step
Semiquantitative PCR
Negative control
Isotype matched irrelevant antibody

Dr. Jelena Mann

Verified customer

Submitted May 01 2007

Application
Western blot
Sample
Mouse Cell lysate - whole cell (3T3 cells)
Loading amount
200000 cells
Specification
3T3 cells
Blocking step
Milk as blocking agent for 1 hour(s) and 0 minute(s) · Concentration: 5%

Abcam user community

Verified customer

Submitted Dec 27 2006

Answer

Thank you for your enquiry. This antibody was tested for its capacity to immunoprecipitate chromatin here at Abcam. Our laboratory team were responsible for the design and execution of the experiments. I have been in touch with them and the definitions and primer sequences for the SAT regions are as follows. "SAT2" - Accession number X72623 Chr1 hSat2 repeat - F ATCGAATGGAAATGAAAGGAGTCA Chr1 hSat2 repeat - R GACCATTGGATGATTGCAGTCA "SATa" - Accession number M26919 Chr1 hSat alpha - F AAGGTCAATGGCAGAAAAGAA Chr1 hSat alpha - R CAACGAAGGCCACAAGATGTC I hope that this information helps. Please do not hesitate to contact me should you require further assistance.

Read More

Answer

I would like to recommend trying a fixation with ice cold methanol or acetone for 10min and adding triton x100 (0.1%) in the dilution buffer of both primary and secondary antibodies. If you still have problems with this antibody in ICC and WB please let me know and I will arrange for a replacement antibody to be sent to you,

Read More

Answer

I'm sorry to hear you are having problems with ab12405 both in WB and in IHC. For the WB problem, I would like to suggest using a nuclear extract of your cells rather than a whole cell extract as the protein is nuclear. You did not mention the incubation time with the primary antibody, please make sure you incubate overnight at 4C. We have a protocol for histone western blotting that you may want to take a look at, I enclose it here: is protocol refers to western blot detection of Histone proteins derived from purified calf thymus. Please note that protein loadings derived from cellular lysates will need to be determined empirically. For each gel lane between 1-2 mg of total Histone protein solution in 1x sample buffer should prove sufficient. The choice of sample buffer will vary depending on the type of gel used (i.e. Tris / glycine or Tris / Tricine SDS PAGE). N.B. A higher percentage gel such as 10-20% Tricine SDS-polyacrylamide is recommended for effective resolution of Histone proteins The sample should be supplemented with 5% (v/v) b-mercaptoethanol and heated to around 95°C for 5 min. The sample should be centrifuged briefly to restore sample volume from condensation formation in the eppendorf during heating. Load the protein samples onto the appropriate SDS-polyacrylamide gel and run the gel under standard conditions. NB it is advisable not to run the dye front completely off the gel when dealing with smaller protein resolutions. For protein transfer from the gel please refer to the protocols supplied with your transfer apparatus, as these will vary depending upon the method of transfer employed i.e. semi-dry blotting or wet blotting. N.B. Nitrocellulose membranes with a pore size of 0.2 mm are recommended for optimal retention of Histone proteins. Transfer times between 30 min and 90 min should prove sufficient for effective protein transfer. Visualise equivalent protein loadings using Ponceau staining Block the membranes by adding an appreciable volume of blocking buffer (5% (w/v) BSA, 0.5% (v/v) Tween-20 in TBS or PBS as preferred). Incubate for 1 h at room temperature by gentle rotation. Dilute the primary antibody in blocking buffer as suggested in the datasheet protocols and incubate the blots overnight at 4°C with gentle rotation. N.B. If you wish to perform blocking peptide studies then a final concentration of between 0.1 and 1.0 mg/ml peptide should be pre-incubated with the antibody for around 20 min at room temperature before the blots are added. Rinse the blots briefly in PBS or TBS then perform two 5 min washes in blocking buffer. Prepare the relevant secondary antibody conjugate in blocking buffer and incubate the blots for 1 h at room temperature with gentle rotation. Wash the blots with three 5 min washes in blocking buffer and then perform a final rinse in PBS or TBS. Perform ECL, ECF or infrared detection as described by the manufacturer. Top Tips for Successful Western blotting with our range of Histone antibodies. · Use a high percentage gel for clear resolution of Histone proteins. · Use nitrocellulose membrane with a pore size of 0.2 mm to ensure optimal capture of Histone proteins. · Use high quality BSA in your blocking solutions rather than conventional dried milk such as Marvel. We also recommend HeLa nuclear extract as a positive control, you may wish to try this in parallel. If you still have a problem do not hesitate to contact us again,

Read More

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"

Sign up