
  • Product name

    Anti-NeuroD2 antibody [EPR5135]
    See all NeuroD2 primary antibodies
  • Description

    Rabbit monoclonal [EPR5135] to NeuroD2
  • Host species

  • Tested applications

    Suitable for: ChIP, WBmore details
    Unsuitable for: Flow Cyt,ICC/IF or IP
  • Species reactivity

    Reacts with: Mouse, Rat, Human
  • Immunogen

    Synthetic peptide within Human NeuroD2 aa 350-450. The exact sequence is proprietary.

  • Positive control

    • WB: Human cerebellum, Human hippocampus, and fetal brain, Mouse cerebellum, Rat cerebellum lysates
  • General notes



    Our RabMAb® technology is a patented hybridoma-based technology for making rabbit monoclonal antibodies. For details on our patents, please refer to RabMab® patents.

    We are constantly working hard to ensure we provide our customers with best in class antibodies. As a result of this work we are pleased to now offer this antibody in purified format. We are in the process of updating our datasheets. The purified format is designated 'PUR' on our product labels. If you have any questions regarding this update, please contact our Scientific Support team.

    This product is a recombinant rabbit monoclonal antibody.



Our Abpromise guarantee covers the use of ab109406 in the following tested applications.

The application notes include recommended starting dilutions; optimal dilutions/concentrations should be determined by the end user.

Application Abreviews Notes
ChIP Use at an assay dependent concentration.
WB 1/1000 - 1/10000. Detects a band of approximately 48 kDa (predicted molecular weight: 41 kDa).
  • Application notes
    Is unsuitable for Flow Cyt,ICC/IF or IP.
  • Target


    • All lanes : Anti-NeuroD2 antibody [EPR5135] (ab109406) at 1/1000 dilution (Purified)

      Lane 1 : Mouse cerebellum lysates
      Lane 2 : Rat cerebellum lysates

      Lysates/proteins at 15 µg per lane.

      All lanes : Goat Anti-Rabbit IgG H&L (HRP) (ab97051) at 1/20000 dilution

      Predicted band size: 41 kDa
      Observed band size: 48 kDa
      why is the actual band size different from the predicted?

    • All lanes : Anti-NeuroD2 antibody [EPR5135] (ab109406) at 1/1000 dilution (Purified)

      Lane 1 : Human cerebellum lysates at 20 µg
      Lane 2 : Human fetal brain lysates at 20 µg

      All lanes : Goat Anti-Rabbit IgG (HRP) with minimal cross-reactivity with human IgG at 1/2000 dilution

      Predicted band size: 41 kDa
      Observed band size: 48 kDa why is the actual band size different from the predicted?

    • ChIP analysis using ab109406 binding NeuroD2 in cerebral cortex tissue lysate from postnatal day 0 mouse. Cells were cross-linked for 10 minutes with 1% formaldehyde. Samples were incubated with primary antibody (1/200) for 2 hours at 4°C.

      Positive control: Known target of NeuroD2, which is the promoter regions of Nhlh2 gene.
      Primer sequence for PCR was:
      Negative Control: ChIP performed with unrelated antibody (anti-GFP antibody).

      See Abreview

    • All lanes : Anti-NeuroD2 antibody [EPR5135] (ab109406) at 1/1000 dilution

      Lane 1 : Human cerebellum lysate
      Lane 2 : Human hippocampus lysate
      Lane 3 : Human fetal brain lysates

      Lysates/proteins at 10 µg per lane.

      Predicted band size: 41 kDa
      Observed band size: 48 kDa why is the actual band size different from the predicted?


    This product has been referenced in:

    • van Weert LTCM  et al. Mechanistic Insights in NeuroD Potentiation of Mineralocorticoid Receptor Signaling. Int J Mol Sci 20:N/A (2019). Read more (PubMed: 30934833) »
    • Bayam E  et al. Genome-wide target analysis of NEUROD2 provides new insights into regulation of cortical projection neuron migration and differentiation. BMC Genomics 16:681 (2015). Mouse . Read more (PubMed: 26341353) »
    See all 4 Publications for this product

    Customer reviews and Q&As

    1-5 of 5 Abreviews or Q&A

    This product is known to not work in this application or species.
    Immuno-precipitation step
    Protein A/G
    Mouse Cell lysate - whole cell (Neuro2A cell line)
    Neuro2A cell line
    Transfected with NeuroD2-myc or emtpty vector pcDNA4
    Total protein in input
    200 µg

    Abcam user community

    Verified customer

    Submitted Jul 11 2014

    Western blot
    Loading amount
    10 µg
    Gel Running Conditions
    Reduced Denaturing (10% SDS-PAGE)
    Mouse Cell lysate - whole cell (mouse N2A cell line)
    mouse N2A cell line
    Transfected with NeuroD2 expressing vector
    Blocking step
    Milk as blocking agent for 1 hour(s) and 0 minute(s) · Concentration: 5% · Temperature: RT°C

    Abcam user community

    Verified customer

    Submitted May 13 2014

    Detection step
    Mouse Tissue lysate - whole (Cerebral cortex tissue from postnatal day 0 mouse)
    Cerebral cortex tissue from postnatal day 0 mouse
    Negative control
    ChIP performed with unrelated antibody (anti-GFP antibody).
    Cross-linking (X-ChIP)
    Duration of cross-linking step: 10 minute(s) and 0 second(s)
    Specification of the cross-linking agent: 1% formaldehyde
    Positive control
    Known target of NeuroD2, which is the promoter regions of Nhlh2 gene. Primer sequence for PCR was: Nhlh2_F CTCACGAACTTCACCCGCAC Nhlh2_R AAATTGACTCCTCGGCCCTC

    Abcam user community

    Verified customer

    Submitted Apr 18 2014


    According to our records, ab109406 was proving difficult to use and we were in contact in order to help resolve the issue.

    Looking at our correspondence, it appears that we are awaiting more details in order to help us better understand the difficulties experienced. If the requested information has already been sent, it appears that it did not reach our Scientific Support team and we apologize for this inconvenience. In this case we would like to ask for the information again so that we can reach a resolution.

    If the issue has already been settled, please let us know so that we can be assured that the problem has been solved to your satisfaction and update our records.

    We wish you the best of luck with your research and look forward to a reply.

    Read More


    Thank you for contacting us and for letting us know about the trouble with ab109406.

    I have attached the protocol that was used by the lab to test this antibody.

    Could you tell me a bit more about the problem and the protocol used, and I'll see if there are any specific suggestions to make? What kind of tissue are you staining, and what methods have you tried?

    I look forward to hearing from you. We do guarantee this antibody to work in IHC-P with mouse, rat, and human tissue for up to six months after purchase, so I will be happy to send a replacement or issue a credit or refund if necessary.

    Please let me know if you have any questions or if there is anything else that we can do for you, and I'll be happy to help.

    Read More

    For licensing inquiries, please contact partnerships@abcam.com

    Sign up