ChIP abreview for Anti-NeuroD2 [EPR5135] antibody - ChIP Grade

Excellent
Abreviews
Application
ChIP
Detection step
Other
Sample
Mouse Tissue lysate - whole (Cerebral cortex tissue from postnatal day 0 mouse)
Specification
Cerebral cortex tissue from postnatal day 0 mouse
Negative control
ChIP performed with unrelated antibody (anti-GFP antibody).
Type
Cross-linking (X-ChIP)
Duration of cross-linking step: 10 minute(s) and 0 second(s)
Specification of the cross-linking agent: 1% formaldehyde
Positive control
Known target of NeuroD2, which is the promoter regions of Nhlh2 gene. Primer sequence for PCR was: Nhlh2_F CTCACGAACTTCACCCGCAC Nhlh2_R AAATTGACTCCTCGGCCCTC

Other product details

Incubation time
2 hour(s) and 0 minute(s) · Temperature: 4°C
Dilution
1/200

Additional data

Abcam response
We are very happy that this antibody provided good results for this customer. Since the customer obtained positive results in ChiP, we decided to re-test this antibody in IP to determine its suitability for this application. The lab re-tested the same lot used by the customer in his ChiP assay. Unfortunately, the results obtained were negative therefore we still do not recommend this antibody in IP. Please feel free to contact our Scientific Support team if you have some feedback you would like to share and/or if you have any question in this matter.

Abcam user community

Verified customer

Submitted Apr 18 2014

Sign up