Nrf2 Transcription Factor Assay Kit (Colorimetric) (ab207223)
Key features and details
- Assay type: Semi-quantitative
- Detection method: Colorimetric
- Platform: Microplate reader
- Assay time: 3 hr 30 min
- Sample type: Nuclear Extracts
- Sensitivity: 600 ng/well
Overview
-
Product name
Nrf2 Transcription Factor Assay Kit (Colorimetric)
See all Nrf2 kits -
Detection method
Colorimetric -
Sample type
Nuclear Extracts -
Assay type
Semi-quantitative -
Sensitivity
> 600 ng/well -
Assay time
3h 30m -
Species reactivity
Reacts with: Mouse, Rat, Human -
Product overview
Nrf2 Transcription Factor Assay Kit (Colorimetric) (ab207223) is a high throughput assay to quantify Nrf2 activation in nuclear extracts. This assay combines a quick ELISA format with a sensitive and specific non-radioactive assay for transcription factor activation.
A specific double stranded DNA sequence containing the Nrf2 consensus binding site (5’ – GTCACAGTGACTCAGCAGAATCTG – 3’) has been immobilized onto a 96-well plate. Active Nrf2 present in the nuclear extract specifically binds to the oligonucleotide. Nrf2 is detected by a primary antibody that recognizes an epitope of Nrf2 accessible only when the protein is activated and bound to its target DNA. An HRP-conjugated secondary antibody provides sensitive colorimetric readout at OD 450 nm. This product detects only human, mouse and rat Nrf2.
Key performance and benefits:
Assay time: 3.5 hours (cell extracts preparation not included).
Detection limit: < 0.6 µg nuclear extract/well.
Detection range: 0.6 – 10 µg nuclear extract/well.
-
Notes
Nrf2 (NF-E2 related factor, NFE2L2, from nuclear factor erythroid-derived 2-like 2) is a basic leucine zipper (bZIP) transcription factor. Nrf2 binds to the antioxidant response element (ARE) and positively regulates the expression of detoxifying enzyme genes (such as NAD(P)H:quinone oxidoreductase1, NQO1) in response to antioxidants and xenobiotics. Higher levels of NQO1 gene expression has been shown in liver, lung, colon, and breast tumors.
A cytosolic inhibitor of Nrf2, Keap1/INrf2, retains Nrf2 in the cytoplasm under normal conditions where the interaction of Nrf2 with INrf2 targets Nrf2 for ubiquitination and proteasomal degradation. However, after oxidative stress, Nrf2 is released from INrf2, translocates to the nucleus, and results in the activation of ARE-mediated gene expression. Nrf2 is also synthesized de novo after exposure to stress. In addition, Nrf2 controls its own degradation by regulating expression and induction of INrf2.
It has been shown that nuclear export and degradation pathways are activated by around two hours after treatment with tert-butylhydroquinone (t-BHQ).
Nrf2 activation and degradation are important sensing mechanisms in the cellular response for oxidative and electrophilic stressors.
-
Platform
Microplate reader
Properties
-
Storage instructions
Please refer to protocols. -
Components 1 x 96 tests 5 x 96 tests 10X Antibody Binding Buffer 1 x 2.2ml 1 x 11ml 10X Wash Buffer 1 x 22ml 1 x 110ml 96-well Nrf2 assay plate 1 unit 5 units Anti-rabbit HRP-conjugated IgG (0.25 μg/μL) 1 x 10µl 1 x 55µl Binding Buffer 1 x 10ml 1 x 50ml Developing Solution 1 x 11ml 1 x 55ml Dithiothreitol (DTT) (1 M) 1 x 100µl 1 x 500µl Herring sperm DNA (1 μg/μL) 1 x 100µl 1 x 500µl Lysis Buffer 1 x 10ml 1 x 50ml Mutated oligonucleotide (10 pmol/µL) 1 x 100µl 1 x 500µl Nrf2 antibody 1 x 10µl 1 x 25µl Plate sealer 1 unit 5 units Positive control extract (2.5 µg/µL) 1 x 20µl 1 x 50µl Protease Inhibitor Cocktail 1 x 100µl 1 x 500µl Stop Solution 1 x 11ml 1 x 55ml Wild-type oligonucleotide (10 pmol/µL) 1 x 100µl 1 x 500µl -
Research areas
-
Function
Transcription activator that binds to antioxidant response (ARE) elements in the promoter regions of target genes. Important for the coordinated up-regulation of genes in response to oxidative stress. May be involved in the transcriptional activation of genes of the beta-globin cluster by mediating enhancer activity of hypersensitive site 2 of the beta-globin locus control region. -
Tissue specificity
Widely expressed. Highest expression in adult muscle, kidney, lung, liver and in fetal muscle. -
Sequence similarities
Belongs to the bZIP family. CNC subfamily.
Contains 1 bZIP domain. -
Domain
Acidic activation domain in the N-terminus, and DNA binding domain in the C-terminus. -
Post-translational
modificationsPhosphorylation of Ser-40 by PKC in response to oxidative stress dissociates NFE2L2 from its cytoplasmic inhibitor KEAP1, promoting its translocation into the nucleus. -
Cellular localization
Cytoplasm > cytosol. Nucleus. Cytosolic under unstressed conditions, translocates into the nucleus upon induction by electrophilic agents. - Information by UniProt
-
Alternative names
- erythroid derived 2
- HEBP1
- like 2
see all -
Database links
- Entrez Gene: 4780 Human
- Entrez Gene: 18024 Mouse
- Entrez Gene: 83619 Rat
- Omim: 600492 Human
- SwissProt: Q16236 Human
- SwissProt: Q60795 Mouse
- SwissProt: O54968 Rat
- Unigene: 744006 Human
see all
Associated products
Images
-
Nuclear extracts from untreated HepG2 cells (Light gray) and HepG2 cells treated with D,L Sulforaphane (Black) were assayed from 0.625 to 10 µg/well for Nrf2 activation using ab207223.
Different amounts of nuclear extracts from untreated HepG2 cells (light grey) and HepG2 cells treated with D,L-Sulforaphane (Black) were tested for Nrf2 activation. These results are provided for demonstration only.
References (3)
ab207223 has been referenced in 3 publications.
- Aliyu NO et al. Lophirones B and C halt acetaminophen hepatotoxicity by upregulating redox transcription factor Nrf-2 through Akt, PI3K, and PKC pathways. J Biochem Mol Toxicol 32:e22055 (2018). PubMed: 29697884
- Czauderna C et al. Ginkgo biloba induces different gene expression signatures and oncogenic pathways in malignant and non-malignant cells of the liver. PLoS One 13:e0209067 (2018). PubMed: 30576355
- Sun L et al. Actinidia chinensis Planch. Improves the Indices of Antioxidant and Anti-Inflammation Status of Type 2 Diabetes Mellitus by Activating Keap1 and Nrf2 via the Upregulation of MicroRNA-424. Oxid Med Cell Longev 2017:7038789 (2017). Human . PubMed: 28642811