For the best experience on the Abcam website please upgrade to a modern browser such as Google Chrome

We use cookies to make our site as useful as possible.

Our Cookie Policy explains how you can opt-out of the cookies we use.

If you continue without changing your cookie settings, we'll assume you’re happy with this.

Continue Continue

United States
Your country/region is currently set to:

If incorrect, please enter your country/region into the box below, to view site information related to your country/region.

Call (888) 77-ABCAM (22226) or contact us
Need help? Contact us

  • My account
  • Sign out
Sign in or Register with us

Welcome

Sign in or

Don't have an account?

Register with us
My basket
Quick order
Abcam homepage

  • Research Products
    By product type
    Primary antibodies
    Secondary antibodies
    ELISA and Matched Antibody Pair Kits
    Cell and tissue imaging tools
    Cellular and biochemical assays
    Proteins and Peptides
    By product type
    Proteomics tools
    Agonists, activators, antagonists and inhibitors
    Cell lines and Lysates
    Multiplex miRNA assays
    Multiplex Assays
    By research area
    Cancer
    Cardiovascular
    Cell Biology
    Epigenetics
    Metabolism
    Developmental Biology
    By research area
    Immunology
    Microbiology
    Neuroscience
    Signal Transduction
    Stem Cells
  • Diagnostic & Therapeutic Solutions
    Custom solutions & partnerships

    Custom antibody development and commercial partnerships to advance your diagnostic and therapeutic discovery.

    Create custom solutions with us

    Partner with us

  • Support
    Support hub

    Access advice and support for any research roadblock

    View support hub

    Protocols

    Your experiments laid out step by step

    View protocols

  • Events
    • Conference calendar
    • Cancer
    • Cardiovascular
    • Epigenetics & Nuclear signaling
    • Immunology
    • Neuroscience
    • Stem cells
    • Tradeshows
    • Scientific webinars
    Keep up to date with the latest events

    Full event breakdown with abstracts, speakers, registration and more

    View global event calendar

  • Pathways
    Cell signalling pathways

    View all pathways

    View all interactive pathways

Supporting our customers and employees during the COVID-19 pandemic. Read more

  1. Link

    nrf2-transcription-factor-assay-kit-colorimetric-ab207223.pdf

  1. Send me a copy of this email
    I agree to the terms and conditions.
Epigenetics and Nuclear Signaling Transcription Other factors
Share by email

Nrf2 Transcription Factor Assay Kit (Colorimetric) (ab207223)

  • Datasheet
  • SDS
  • Protocol Booklet
Submit a review Submit a question References (3)

Product price, shipping and contact information

Currently unavailable

Sorry, we can't display this right now.

Please contact us to place your order, or try again later.

 

Loading size & price…

 

Shipping and order information

Abpromise

Guaranteed product quality, expert customer support.

Find out more.

Nuclear extracts from untreated HepG2 cells (Light gray) and HepG2 cells treated with D,L Sulforaphane (Black) were assayed from 0.625 to 10 µg/well for Nrf2 activation using ab207223.

    Key features and details

    • Assay type: Semi-quantitative
    • Detection method: Colorimetric
    • Platform: Microplate reader
    • Assay time: 3 hr 30 min
    • Sample type: Nuclear Extracts
    • Sensitivity: 600 ng/well

    You may also be interested in

    Biochemical
    Cheirolin, Nrf2 inducer (ab142855)

    View more associated products

    Overview

    • Product name

      Nrf2 Transcription Factor Assay Kit (Colorimetric)
      See all Nrf2 kits
    • Detection method

      Colorimetric
    • Sample type

      Nuclear Extracts
    • Assay type

      Semi-quantitative
    • Sensitivity

      > 600 ng/well
    • Assay time

      3h 30m
    • Species reactivity

      Reacts with: Mouse, Rat, Human
    • Product overview

      Nrf2 Transcription Factor Assay Kit (Colorimetric) (ab207223) is a high throughput assay to quantify Nrf2 activation in nuclear extracts. This assay combines a quick ELISA format with a sensitive and specific non-radioactive assay for transcription factor activation.


      A specific double stranded DNA sequence containing the Nrf2 consensus binding site (5’ – GTCACAGTGACTCAGCAGAATCTG – 3’) has been immobilized onto a 96-well plate. Active Nrf2 present in the nuclear extract specifically binds to the oligonucleotide. Nrf2 is detected by a primary antibody that recognizes an epitope of Nrf2 accessible only when the protein is activated and bound to its target DNA. An HRP-conjugated secondary antibody provides sensitive colorimetric readout at OD 450 nm. This product detects only human, mouse and rat Nrf2.


      Key performance and benefits:


      Assay time: 3.5 hours (cell extracts preparation not included).


      Detection limit: < 0.6 µg nuclear extract/well.


      Detection range: 0.6 – 10 µg nuclear extract/well.

    • Notes

      Nrf2 (NF-E2 related factor, NFE2L2, from nuclear factor erythroid-derived 2-like 2) is a basic leucine zipper (bZIP) transcription factor. Nrf2 binds to the antioxidant response element (ARE) and positively regulates the expression of detoxifying enzyme genes (such as NAD(P)H:quinone oxidoreductase1, NQO1) in response to antioxidants and xenobiotics. Higher levels of NQO1 gene expression has been shown in liver, lung, colon, and breast tumors.

      A cytosolic inhibitor of Nrf2, Keap1/INrf2, retains Nrf2 in the cytoplasm under normal conditions where the interaction of Nrf2 with INrf2 targets Nrf2 for ubiquitination and proteasomal degradation. However, after oxidative stress, Nrf2 is released from INrf2, translocates to the nucleus, and results in the activation of ARE-mediated gene expression. Nrf2 is also synthesized de novo after exposure to stress. In addition, Nrf2 controls its own degradation by regulating expression and induction of INrf2.

      It has been shown that nuclear export and degradation pathways are activated by around two hours after treatment with tert-butylhydroquinone (t-BHQ).

      Nrf2 activation and degradation are important sensing mechanisms in the cellular response for oxidative and electrophilic stressors.

    • Platform

      Microplate reader

    Properties

    • Storage instructions

      Please refer to protocols.
    • Components 1 x 96 tests 5 x 96 tests
      10X Antibody Binding Buffer 1 x 2.2ml 1 x 11ml
      10X Wash Buffer 1 x 22ml 1 x 110ml
      96-well Nrf2 assay plate 1 unit 5 units
      Anti-rabbit HRP-conjugated IgG (0.25 μg/μL) 1 x 10µl 1 x 55µl
      Binding Buffer 1 x 10ml 1 x 50ml
      Developing Solution 1 x 11ml 1 x 55ml
      Dithiothreitol (DTT) (1 M) 1 x 100µl 1 x 500µl
      Herring sperm DNA (1 μg/μL) 1 x 100µl 1 x 500µl
      Lysis Buffer 1 x 10ml 1 x 50ml
      Mutated oligonucleotide (10 pmol/µL) 1 x 100µl 1 x 500µl
      Nrf2 antibody 1 x 10µl 1 x 25µl
      Plate sealer 1 unit 5 units
      Positive control extract (2.5 µg/µL) 1 x 20µl 1 x 50µl
      Protease Inhibitor Cocktail 1 x 100µl 1 x 500µl
      Stop Solution 1 x 11ml 1 x 55ml
      Wild-type oligonucleotide (10 pmol/µL) 1 x 100µl 1 x 500µl
    • Research areas

      • Epigenetics and Nuclear Signaling
      • Transcription
      • Other factors
      • Cell Biology
      • Other Antibodies
      • Oxidative Stress
      • Cardiovascular
      • Heart
      • Cardiac metabolism
      • Metabolism
      • Pathways and Processes
      • Mitochondrial Metabolism
      • Mitochondrial Biogenesis
      • Metabolism
      • Pathways and Processes
      • Metabolic signaling pathways
      • Nucleotide metabolism
      • Molecular processes
      • Mitochondrial transcription
      • Metabolism
      • Pathways and Processes
      • Redox metabolism
      • Oxidative stress
    • Function

      Transcription activator that binds to antioxidant response (ARE) elements in the promoter regions of target genes. Important for the coordinated up-regulation of genes in response to oxidative stress. May be involved in the transcriptional activation of genes of the beta-globin cluster by mediating enhancer activity of hypersensitive site 2 of the beta-globin locus control region.
    • Tissue specificity

      Widely expressed. Highest expression in adult muscle, kidney, lung, liver and in fetal muscle.
    • Sequence similarities

      Belongs to the bZIP family. CNC subfamily.
      Contains 1 bZIP domain.
    • Domain

      Acidic activation domain in the N-terminus, and DNA binding domain in the C-terminus.
    • Post-translational
      modifications

      Phosphorylation of Ser-40 by PKC in response to oxidative stress dissociates NFE2L2 from its cytoplasmic inhibitor KEAP1, promoting its translocation into the nucleus.
    • Cellular localization

      Cytoplasm > cytosol. Nucleus. Cytosolic under unstressed conditions, translocates into the nucleus upon induction by electrophilic agents.
    • Target information above from: UniProt accession Q16236 The UniProt Consortium
      The Universal Protein Resource (UniProt) in 2010
      Nucleic Acids Res. 38:D142-D148 (2010) .

      Information by UniProt
    • Alternative names

      • erythroid derived 2
      • HEBP1
      • like 2
      • NF E2 related factor 2
      • NF-E2-related factor 2
      • NF2L2_HUMAN
      • NFE2 related factor 2
      • NFE2-related factor 2
      • Nfe2l2
      • Nrf 2
      • NRF2
      • Nuclear factor
      • Nuclear factor (erythroid derived 2) like 2
      • nuclear factor erythroid 2 like 2
      • Nuclear factor erythroid 2 related factor 2
      • Nuclear factor erythroid 2-related factor 2
      • Nuclear factor erythroid derived 2 like 2
      see all
    • Database links

      • Entrez Gene: 4780 Human
      • Entrez Gene: 18024 Mouse
      • Entrez Gene: 83619 Rat
      • Omim: 600492 Human
      • SwissProt: Q16236 Human
      • SwissProt: Q60795 Mouse
      • SwissProt: O54968 Rat
      • Unigene: 744006 Human
      • Unigene: 1025 Mouse
      • Unigene: 10867 Rat
      see all

    Associated products

      Images

      • Nuclear extracts from untreated HepG2 cells (Light gray) and HepG2 cells treated with D,L Sulforaphane (Black) were assayed from 0.625 to 10 µg/well for Nrf2 activation using ab207223.
        Nuclear extracts from untreated HepG2 cells (Light gray) and HepG2 cells treated with D,L Sulforaphane (Black) were assayed from 0.625 to 10 µg/well for Nrf2 activation using ab207223.

        Different amounts of nuclear extracts from untreated HepG2 cells (light grey) and HepG2 cells treated with D,L-Sulforaphane (Black) were tested for Nrf2 activation.  These results are provided for demonstration only.

      Protocols

      • Protocol Booklet

      Click here to view the general protocols

      Datasheets and documents

      • Datasheet
      • SDS
    • References (3)

      Publishing research using ab207223? Please let us know so that we can cite the reference in this datasheet.

      ab207223 has been referenced in 3 publications.

      • Aliyu NO  et al. Lophirones B and C halt acetaminophen hepatotoxicity by upregulating redox transcription factor Nrf-2 through Akt, PI3K, and PKC pathways. J Biochem Mol Toxicol 32:e22055 (2018). PubMed: 29697884
      • Czauderna C  et al. Ginkgo biloba induces different gene expression signatures and oncogenic pathways in malignant and non-malignant cells of the liver. PLoS One 13:e0209067 (2018). PubMed: 30576355
      • Sun L  et al. Actinidia chinensis Planch. Improves the Indices of Antioxidant and Anti-Inflammation Status of Type 2 Diabetes Mellitus by Activating Keap1 and Nrf2 via the Upregulation of MicroRNA-424. Oxid Med Cell Longev 2017:7038789 (2017). Human . PubMed: 28642811

      Customer reviews and Q&As

      Show All Reviews Q&A
      Submit a review Submit a question

      There are currently no Customer reviews or Questions for ab207223.
      Please use the links above to contact us or submit feedback about this product.

      Please note: All products are "FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES"
      For licensing inquiries, please contact partnerships@abcam.com

      Get resources and offers direct to your inbox Sign up
      A-Z by research area
      • Cancer
      • Cardiovascular
      • Cell biology
      • Developmental biology
      • Epigenetics & Nuclear signaling
      • Immunology
      • Metabolism
      • Microbiology
      • Neuroscience
      • Signal transduction
      • Stem cells
      A-Z by product type
      • Primary antibodies
      • Secondary antibodies
      • Biochemicals
      • Isotype controls
      • Flow cytometry multi-color selector
      • Kits
      • Loading controls
      • Lysates
      • Peptides
      • Proteins
      • Slides
      • Tags and cell markers
      • Tools & Reagents
      Help & support
      • Support
      • Make an Inquiry
      • Protocols & troubleshooting
      • Placing an order
      • RabMAb products
      • Biochemical product FAQs
      • Training
      • Browse by Target
      Company
      • Corporate site
      • Investor relations
      • Company news
      • Careers
      • About us
      • Blog
      Events
      • Tradeshows
      • Conferences
      International websites
      • abcam.cn
      • abcam.co.jp

      Join with us

      • LinkedIn
      • facebook
      • Twitter
      • YouTube
      • Terms of sale
      • Website terms of use
      • Cookie policy
      • Privacy policy
      • Legal
      • Modern slavery statement
      © 1998-2021 Abcam plc. All rights reserved.