Overview

  • Product name
    Anti-Pit1 antibody [5E4]
    See all Pit1 primary antibodies
  • Description
    Mouse monoclonal [5E4] to Pit1
  • Host species
    Mouse
  • Tested applications
    Suitable for: WB, ICC/IF, IPmore details
  • Species reactivity
    Reacts with: Mouse
    Predicted to work with: Rat, Sheep, Cow, Human, Pig, Macaque monkey
  • Immunogen

    Recombinant fragment:

    SAAECLPASN HATNVMSTAT GLHYSVPSCH YGNQPSTYGV MAGSLTPCLY KFPDHTLSHG FPPLHQPLLA EDPAASEFKQ ELRRKSKLVEE PIDMDSPEIR ELEQFANEFK VRRIKL

    , corresponding to amino acids 30-146 of Rat Pit1.

Properties

  • Form
    Liquid
  • Storage instructions
    Shipped at 4°C. Upon delivery aliquot and store at -20°C or -80°C. Avoid repeated freeze / thaw cycles.
  • Storage buffer
    Tissue culture media: 15% FBS, DMEN 4.5g/litre glucose and 10% NCTC 109.
    Additives: bovine insulin, oxaloacetic acid, glycine, L-glutamine and pen-strep.
  • Purity
    Tissue culture supernatant
  • Clonality
    Monoclonal
  • Clone number
    5E4
  • Myeloma
    NS1
  • Isotype
    IgG2a
  • Light chain type
    kappa
  • Research areas

Applications

Our Abpromise guarantee covers the use of ab10545 in the following tested applications.

The application notes include recommended starting dilutions; optimal dilutions/concentrations should be determined by the end user.

Application Abreviews Notes
WB 1/40. Detects a band of approximately 31 kDa (predicted molecular weight: 33 kDa).
ICC/IF Use at an assay dependent concentration.
IP Use at an assay dependent concentration.

Target

  • Function
    Transcription factor involved in the specification of the lactotrope, somatotrope, and thyrotrope phenotypes in the developing anterior pituitary. Activates growth hormone and prolactin genes. Specifically binds to the consensus sequence 5'-TAAAT-3'.
  • Involvement in disease
    Defects in POU1F1 are the cause of pituitary hormone deficiency combined type 1 (CPHD1) [MIM:613038]. CPHD is characterized by impaired production of growth hormone (GH) and one or more of the other five anterior pituitary hormones.
  • Sequence similarities
    Belongs to the POU transcription factor family. Class-1 subfamily.
    Contains 1 homeobox DNA-binding domain.
    Contains 1 POU-specific domain.
  • Cellular localization
    Nucleus.
  • Information by UniProt
  • Database links
  • Alternative names
    • Dwarf antibody
    • GHF 1 antibody
    • GHF 1A antibody
    • GHF-1 antibody
    • GHF1 antibody
    • GHF1A antibody
    • Growth hormone factor 1 antibody
    • Hmp 1 antibody
    • Hmp1 antibody
    • Pit 1 antibody
    • Pit 1 beta antibody
    • PIT 1Z antibody
    • PiT-1 antibody
    • Pit1 beta antibody
    • PIT1_HUMAN antibody
    • PIT1Z antibody
    • Pituitary growth hormone antibody
    • Pituitary specific positive transcription factor 1 antibody
    • Pituitary-specific positive transcription factor 1 antibody
    • POU class 1 homeobox 1 antibody
    • POU domain class 1 transcription factor 1 antibody
    • POU domain transcriptional regulator antibody
    • POU1F1 antibody
    see all

Images

  • At 1:40 dilution the western was very good on GH3 nuclear lysate which has an abundant expression of Pit1.

    At 1:40 dilution the western was very good on GH3 nuclear lysate which has an abundant expression of Pit1.
  • IF using ab10545 carried out as per the reference (see below) by Zelton Dave Sharp of The University of Texas, San Antonio.
  • Antibody to Pit1 (ab10545) detects a 33 kDa band in IP followed by WB.

References

This product has been referenced in:
  • Choi SY  et al. Dipeptidyl peptidase-4 inhibitor gemigliptin protects against vascular calcification in an experimental chronic kidney disease and vascular smooth muscle cells. PLoS One 12:e0180393 (2017). WB ; Human . Read more (PubMed: 28686724) »
  • Mancini MG  et al. Subnuclear partitioning and functional regulation of the Pit-1 transcription factor. J Cell Biochem 72:322-38 (1999). Read more (PubMed: 10022514) »
See all 2 Publications for this product

Customer reviews and Q&As

Abreviews
Application
ChIP
Sample
Mouse Cell lysate - nuclear (Thyrotrope cell line (T-alpha-T-1))
Negative control
Empty region (called Ct2, Forward : TGCATAAATCAAATGCCCATA, Reverse : GCAAAGGTGATTTGCAGAAA), Beta-actin promoter region (Forward : CTTCCTTTGTCCCCTGAGCTT, Reverse : TCCATGGCGAACTATCAAGAC).
Specification
Thyrotrope cell line (T-alpha-T-1)
Detection step
Real-time PCR
Type
Cross-linking (X-ChIP)
Duration of cross-linking step: 30 minute(s) and 0 second(s)
Specification of the cross-linking agent: Paraformaldehyde
Positive control
Thyroid stimulating hormone bêta sub-unit (Tshb) promoter region (Forward : CAGAGTTTCCAGGGAGAGGA, Reverse : CGAATTGCTGCTTTCTTATCTG). PIT1 is known to bind this Tshb promoter region in thyrotrope cells (Yumiko Kashiwabara, et al. 2009).

Mr. Vincent Pacini

Verified customer

Submitted Mar 26 2019

Please note: All products are "FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES"
For licensing inquiries, please contact partnerships@abcam.com

Sign up