For the best experience on the Abcam website please upgrade to a modern browser such as Google Chrome

Hello. We're improving abcam.com and we'd welcome your feedback.

Hello. We're improving abcam.com and we'd welcome your feedback.

Infomation icon

We haven't added this to the BETA yet

New BETA website

New BETA website

Hello. We're improving abcam.com and we'd welcome your feedback.

Take a look at our BETA site and see what we’ve done so far.

Switch on our new BETA site

Now available

Search and browse selected products

  • A selection of primary antibodies

Purchase these through your usual distributor

In the coming months

  • Additional product types
  • Supporting content
  • Sign in to your account
  • Purchase online
United States
Your country/region is currently set to:

If incorrect, please enter your country/region into the box below, to view site information related to your country/region.

Call (888) 77-ABCAM (22226) or contact us
Need help? Contact us

  • My account
  • Sign out
Sign in or Register with us

Welcome

Sign in or

Don't have an account?

Register with us
My basket
Quick order
Abcam homepage

  • Research Products
    By product type
    Primary antibodies
    Secondary antibodies
    ELISA and Matched Antibody Pair Kits
    Cell and tissue imaging tools
    Cellular and biochemical assays
    Proteins and Peptides
    By product type
    Proteomics tools
    Agonists, activators, antagonists and inhibitors
    Cell lines and Lysates
    Multiplex miRNA assays
    Multiplex Assays
    By research area
    Cancer
    Cardiovascular
    Cell Biology
    Epigenetics
    Metabolism
    Developmental Biology
    By research area
    Immunology
    Microbiology
    Neuroscience
    Signal Transduction
    Stem Cells
  • Customized Products & Partnerships
    Customized Products & Partnerships

    Customized products and commercial partnerships to accelerate your diagnostic and therapeutic programs.

    Customized products

    Partner with us

  • Support
    Support hub

    Access advice and support for any research roadblock

    View support hub

    Protocols

    Your experiments laid out step by step

    View protocols

  • Events
    • Conference calendar
    • Cancer
    • Cardiovascular
    • Epigenetics & Nuclear signaling
    • Immunology
    • Neuroscience
    • Stem cells
    • Tradeshows
    • Scientific webinars
    Keep up to date with the latest events

    Full event breakdown with abstracts, speakers, registration and more

    View global event calendar

  • Pathways
    Cell signalling pathways

    View all pathways

    View all interactive pathways

Explore the power of knock-out cell lines for your research

  1. Link

    pit1-antibody-5e4-ab10545.pdf

  1. Send me a copy of this email
    I agree to the terms and conditions.
Epigenetics and Nuclear Signaling Transcription Domain Families Developmental Families POU
Share by email

Anti-Pit1 antibody [5E4] (ab10545)

  • Datasheet
Reviews (1) Submit a question References (3)

Product price, shipping and contact information

Currently unavailable

Sorry, we can't display this right now.

Please contact us to place your order, or try again later.

 

Loading size & price…

 

Shipping and order information

Shipping info

Promotion Information

Abpromise

Guaranteed product quality, expert customer support.

Find out more.

Western blot - Anti-Pit1 antibody [5E4] (ab10545)
  • Immunocytochemistry/ Immunofluorescence - Anti-Pit1 antibody [5E4] (ab10545)
  • Immunoprecipitation - Anti-Pit1 antibody [5E4] (ab10545)

Key features and details

  • Mouse monoclonal [5E4] to Pit1
  • Suitable for: WB, ICC/IF, IP
  • Reacts with: Rat
  • Isotype: IgG2a

Get better batch-to-batch reproducibility with a recombinant antibody

Product image
Anti-Pit1 antibody [EPR23555-203] (ab273048)
  • Research with confidence – consistent and reproducible results with every batch
  • Long-term and scalable supply – powered by recombinant technology for fast production
  • Success from the first experiment – confirmed specificity through extensive validation
  • Ethical standards compliant – production is animal-free

Overview

  • Product name

    Anti-Pit1 antibody [5E4]
    See all Pit1 primary antibodies
  • Description

    Mouse monoclonal [5E4] to Pit1
  • Host species

    Mouse
  • Tested applications

    Suitable for: WB, ICC/IF, IPmore details
  • Species reactivity

    Reacts with: Rat
    Predicted to work with: Sheep, Cow, Human, Pig, Macaque monkey
  • Immunogen

    Recombinant fragment:

    SAAECLPASN HATNVMSTAT GLHYSVPSCH YGNQPSTYGV MAGSLTPCLY KFPDHTLSHG FPPLHQPLLA EDPAASEFKQ ELRRKSKLVEE PIDMDSPEIR ELEQFANEFK VRRIKL

    , corresponding to amino acids 30-146 of Rat Pit1.
    Run BLAST with BLAST the sequence with ExPASy Run BLAST with BLAST the sequence with NCBI
  • General notes

    The Life Science industry has been in the grips of a reproducibility crisis for a number of years. Abcam is leading the way in addressing this with our range of recombinant monoclonal antibodies and knockout edited cell lines for gold-standard validation. Please check that this product meets your needs before purchasing.

    If you have any questions, special requirements or concerns, please send us an inquiry and/or contact our Support team ahead of purchase. Recommended alternatives for this product can be found below, along with publications, customer reviews and Q&As

Properties

  • Form

    Liquid
  • Storage instructions

    Shipped at 4°C. Upon delivery aliquot and store at -20°C or -80°C. Avoid repeated freeze / thaw cycles.
  • Storage buffer

    Tissue culture media: 15% FBS, DMEN 4.5g/litre glucose and 10% NCTC 109.
    Additives: bovine insulin, oxaloacetic acid, glycine, L-glutamine and pen-strep.
  • Concentration information loading...
  • Purity

    Tissue culture supernatant
  • Clonality

    Monoclonal
  • Clone number

    5E4
  • Myeloma

    NS1
  • Isotype

    IgG2a
  • Light chain type

    kappa
  • Research areas

    • Epigenetics and Nuclear Signaling
    • Transcription
    • Domain Families
    • Developmental Families
    • POU

Associated products

  • Compatible Secondaries

    • Goat Anti-Mouse IgG H&L (Alexa Fluor® 488) (ab150113)
    • Goat Anti-Mouse IgG H&L (HRP) (ab205719)
  • Isotype control

    • Mouse IgG2a, kappa monoclonal [MG2a-53] - Isotype control (ab18415)

Applications

The Abpromise guarantee

Our Abpromise guarantee covers the use of ab10545 in the following tested applications.

The application notes include recommended starting dilutions; optimal dilutions/concentrations should be determined by the end user.

Application Abreviews Notes
WB
1/40. Detects a band of approximately 31 kDa (predicted molecular weight: 33 kDa).
ICC/IF
Use at an assay dependent concentration.
IP
Use at an assay dependent concentration.
Notes
WB
1/40. Detects a band of approximately 31 kDa (predicted molecular weight: 33 kDa).
ICC/IF
Use at an assay dependent concentration.
IP
Use at an assay dependent concentration.

Target

  • Function

    Transcription factor involved in the specification of the lactotrope, somatotrope, and thyrotrope phenotypes in the developing anterior pituitary. Activates growth hormone and prolactin genes. Specifically binds to the consensus sequence 5'-TAAAT-3'.
  • Involvement in disease

    Defects in POU1F1 are the cause of pituitary hormone deficiency combined type 1 (CPHD1) [MIM:613038]. CPHD is characterized by impaired production of growth hormone (GH) and one or more of the other five anterior pituitary hormones.
  • Sequence similarities

    Belongs to the POU transcription factor family. Class-1 subfamily.
    Contains 1 homeobox DNA-binding domain.
    Contains 1 POU-specific domain.
  • Cellular localization

    Nucleus.
  • Target information above from: UniProt accession P28069 The UniProt Consortium
    The Universal Protein Resource (UniProt) in 2010
    Nucleic Acids Res. 38:D142-D148 (2010) .

    Information by UniProt
  • Database links

    • Entrez Gene: 282315 Cow
    • Entrez Gene: 5449 Human
    • Entrez Gene: 25517 Rat
    • Entrez Gene: 397325 Sheep
    • Omim: 173110 Human
    • SwissProt: P28069 Human
    • SwissProt: Q04788 Pig
    • SwissProt: P10037 Rat
    • SwissProt: P79364 Sheep
    • Unigene: 591654 Human
    • Unigene: 10445 Rat
    see all
  • Alternative names

    • Dwarf antibody
    • GHF 1 antibody
    • GHF 1A antibody
    • GHF-1 antibody
    • GHF1 antibody
    • GHF1A antibody
    • Growth hormone factor 1 antibody
    • Hmp 1 antibody
    • Hmp1 antibody
    • Pit 1 antibody
    • Pit 1 beta antibody
    • PIT 1Z antibody
    • PiT-1 antibody
    • Pit1 beta antibody
    • PIT1_HUMAN antibody
    • PIT1Z antibody
    • Pituitary growth hormone antibody
    • Pituitary specific positive transcription factor 1 antibody
    • Pituitary-specific positive transcription factor 1 antibody
    • POU class 1 homeobox 1 antibody
    • POU domain class 1 transcription factor 1 antibody
    • POU domain transcriptional regulator antibody
    • POU1F1 antibody
    see all

Images

  • Western blot - Anti-Pit1 antibody [5E4] (ab10545)
    Western blot - Anti-Pit1 antibody [5E4] (ab10545)

    At 1:40 dilution the western was very good on GH3 nuclear lysate which has an abundant expression of Pit1.

  • Immunocytochemistry/ Immunofluorescence - Anti-Pit1 antibody [5E4] (ab10545)
    Immunocytochemistry/ Immunofluorescence - Anti-Pit1 antibody [5E4] (ab10545)This image is courtesy of Zelton Dave Sharp
    IF using ab10545 carried out as per the reference (see below) by Zelton Dave Sharp of The University of Texas, San Antonio.
  • Immunoprecipitation - Anti-Pit1 antibody [5E4] (ab10545)
    Immunoprecipitation - Anti-Pit1 antibody [5E4] (ab10545)

    Antibody to Pit1 (ab10545) detects a 33 kDa band in IP followed by WB.

    Two IgG monoclonal antibodies were used to immunoprecipitate pituitary-derived GH3 cellular proteins, and followed by Western analysis. Whole cell extracts (WCE) and immunoprecipitated fractions contain a prominent 33 kD band representing Pit-1. Nonspecific hybridoma supernatant was used as a negative control. Epitope mapping (data not shown) indicated that both IgG monoclonal antibodies recognize an epitope in the distal N-terminus within the ST activation domain of Pit-1

Protocols

  • Western blot protocols
  • Immunocytochemistry & immunofluorescence protocols

Click here to view the general protocols

Datasheets and documents

  • Datasheet download

    Download

References (3)

Publishing research using ab10545? Please let us know so that we can cite the reference in this datasheet.

ab10545 has been referenced in 3 publications.

  • Huang Y  et al. IRF1-mediated downregulation of PGC1a contributes to cardiorenal syndrome type 4. Nat Commun 11:4664 (2020). PubMed: 32938919
  • Choi SY  et al. Dipeptidyl peptidase-4 inhibitor gemigliptin protects against vascular calcification in an experimental chronic kidney disease and vascular smooth muscle cells. PLoS One 12:e0180393 (2017). WB ; Human . PubMed: 28686724
  • Mancini MG  et al. Subnuclear partitioning and functional regulation of the Pit-1 transcription factor. J Cell Biochem 72:322-38 (1999). PubMed: 10022514

Customer reviews and Q&As

Show All Reviews Q&A
Submit a review Submit a question

ChIP abreview for Anti-Pit1 antibody [5E4]

Excellent
Abreviews
Abreviews
abreview image
Application
ChIP
Sample
Mouse Cell lysate - nuclear (Thyrotrope cell line (T-alpha-T-1))
Negative control
Empty region (called Ct2, Forward : TGCATAAATCAAATGCCCATA, Reverse : GCAAAGGTGATTTGCAGAAA), Beta-actin promoter region (Forward : CTTCCTTTGTCCCCTGAGCTT, Reverse : TCCATGGCGAACTATCAAGAC).
Specification
Thyrotrope cell line (T-alpha-T-1)
Detection step
Real-time PCR
Type
Cross-linking (X-ChIP)
Duration of cross-linking step: 30 minute(s) and 0 second(s)
Specification of the cross-linking agent: Paraformaldehyde
Positive control
Thyroid stimulating hormone bêta sub-unit (Tshb) promoter region (Forward : CAGAGTTTCCAGGGAGAGGA, Reverse : CGAATTGCTGCTTTCTTATCTG). PIT1 is known to bind this Tshb promoter region in thyrotrope cells (Yumiko Kashiwabara, et al. 2009).
Read More
The reviewer received a reward from Abcam’s Loyalty Program in thanks for submitting this Abreview and for helping the scientific community make better-informed decisions.

Mr. Vincent Pacini

Verified customer

Submitted Mar 26 2019

Please note: All products are "FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES"
For licensing inquiries, please contact partnerships@abcam.com

Get resources and offers direct to your inbox Sign up
A-Z by research area
  • Cancer
  • Cardiovascular
  • Cell biology
  • Developmental biology
  • Epigenetics & Nuclear signaling
  • Immunology
  • Metabolism
  • Microbiology
  • Neuroscience
  • Signal transduction
  • Stem cells
A-Z by product type
  • Primary antibodies
  • Secondary antibodies
  • Biochemicals
  • Isotype controls
  • Flow cytometry multi-color selector
  • Kits
  • Loading controls
  • Lysates
  • Peptides
  • Proteins
  • Slides
  • Tags and cell markers
  • Tools & Reagents
Help & support
  • Support
  • Make an Inquiry
  • Protocols & troubleshooting
  • Placing an order
  • RabMAb products
  • Biochemical product FAQs
  • Training
  • Browse by Target
Company
  • Corporate site
  • Investor relations
  • Company news
  • Careers
  • About us
  • Blog
Events
  • Tradeshows
  • Conferences
International websites
  • abcam.cn
  • abcam.co.jp

Join with us

  • LinkedIn
  • facebook
  • Twitter
  • YouTube
  • Terms of sale
  • Website terms of use
  • Cookie policy
  • Privacy policy
  • Legal
  • Modern slavery statement
© 1998-2022 Abcam plc. All rights reserved.