For the best experience on the Abcam website please upgrade to a modern browser such as Google Chrome

We use cookies to make our site as useful as possible.

Our Cookie Policy explains how you can opt-out of the cookies we use.

If you continue without changing your cookie settings, we'll assume you’re happy with this.

Continue Continue

United States
Your country/region is currently set to:

If incorrect, please enter your country/region into the box below, to view site information related to your country/region.

Call (888) 77-ABCAM (22226) or contact us
Need help? Contact us

  • My account
  • Sign out
Sign in or Register with us

Welcome

Sign in or

Don't have an account?

Register with us
My basket
Quick order
Abcam homepage

  • Research Products
    By product type
    Primary antibodies
    Secondary antibodies
    ELISA and Matched Antibody Pair Kits
    Cell and tissue imaging tools
    Cellular and biochemical assays
    Proteins and Peptides
    By product type
    Proteomics tools
    Agonists, activators, antagonists and inhibitors
    Cell lines and Lysates
    Multiplex miRNA assays
    Multiplex Assays
    By research area
    Cancer
    Cardiovascular
    Cell Biology
    Epigenetics
    Metabolism
    Developmental Biology
    By research area
    Immunology
    Microbiology
    Neuroscience
    Signal Transduction
    Stem Cells
  • Diagnostic & Therapeutic Solutions
    Custom solutions & partnerships

    Custom antibody development and commercial partnerships to advance your diagnostic and therapeutic discovery.

    Create custom solutions with us

    Partner with us

  • Support
    Support hub

    Access advice and support for any research roadblock

    View support hub

    Protocols

    Your experiments laid out step by step

    View protocols

  • Events
    • Conference calendar
    • Cancer
    • Cardiovascular
    • Epigenetics & Nuclear signaling
    • Immunology
    • Neuroscience
    • Stem cells
    • Tradeshows
    • Scientific webinars
    Keep up to date with the latest events

    Full event breakdown with abstracts, speakers, registration and more

    View global event calendar

  • Pathways
    Cell signalling pathways

    View all pathways

    View all interactive pathways

Supporting our customers and employees during the COVID-19 pandemic. Read more

  1. Link

    polr3a-antibody-ab96328.pdf

  1. Send me a copy of this email
    I agree to the terms and conditions.
Epigenetics and Nuclear Signaling Transcription Polymerase associated factors Pol III Transcription
Share by email

Anti-POLR3A antibody (ab96328)

  • Datasheet
  • SDS
Reviews (2) Submit a question References (8)

Product price, shipping and contact information

Currently unavailable

Sorry, we can't display this right now.

Please contact us to place your order, or try again later.

 

Loading size & price…

 

Shipping and order information

Abpromise

Guaranteed product quality, expert customer support.

Find out more.

Western blot - Anti-POLR3A antibody (ab96328)

    Key features and details

    • Rabbit polyclonal to POLR3A
    • Suitable for: WB
    • Reacts with: Human
    • Isotype: IgG

    You may also be interested in

    Secondary
    Product image
    Goat Anti-Rabbit IgG H&L (HRP) (ab205718)
    Primary
    Product image
    Anti-Retinoic Acid Receptor alpha antibody [H1920] (ab41934)
    Protein
    Recombinant VZV gE protein (ab43050)

    View more associated products

    Overview

    • Product name

      Anti-POLR3A antibody
      See all POLR3A primary antibodies
    • Description

      Rabbit polyclonal to POLR3A
    • Host species

      Rabbit
    • Tested Applications & Species

      Application Species
      WB
      Human
      See all applications and species data
    • Immunogen

      Recombinant protein fragment contain a sequence corresponding to a region within amino acids 182 and 452 of POLR3A

    Properties

    • Form

      Liquid
    • Storage instructions

      Shipped at 4°C. Store at +4°C short term (1-2 weeks). Upon delivery aliquot. Store at -20°C or -80°C. Avoid freeze / thaw cycle.
    • Storage buffer

      pH: 7.00
      Preservative: 0.025% Proclin 300
      Constituents: 78% PBS, 1% BSA, 20% Glycerol (glycerin, glycerine)
    • Concentration information loading...
    • Purity

      Immunogen affinity purified
    • Clonality

      Polyclonal
    • Isotype

      IgG
    • Research areas

      • Epigenetics and Nuclear Signaling
      • Transcription
      • Polymerase associated factors
      • Pol III Transcription
      • Epigenetics and Nuclear Signaling
      • Transcription
      • RNA polymerase

    Associated products

    • ChIP Related Products

      • ChIP Kit (ab500)
    • Compatible Secondaries

      • Goat Anti-Rabbit IgG H&L (Alexa Fluor® 488) (ab150077)
      • Goat Anti-Rabbit IgG H&L (HRP) (ab205718)
    • Isotype control

      • Rabbit IgG, polyclonal - Isotype Control (ChIP Grade) (ab171870)
    • Positive Controls

      • HeLa whole cell lysate (ab29545)
      • A549 whole cell lysate (ab7910)

    Applications

    The Abpromise guarantee

    Our Abpromise guarantee covers the use of ab96328 in the following tested applications.

    The application notes include recommended starting dilutions; optimal dilutions/concentrations should be determined by the end user.

    Guaranteed

    Tested applications are guaranteed to work and covered by our Abpromise guarantee.

    Predicted

    Predicted to work for this combination of applications and species but not guaranteed.

    Incompatible

    Does not work for this combination of applications and species.

    Application Species
    WB
    Human
    All applications
    Cow
    Application Abreviews Notes
    WB
    1/500 - 1/3000. Predicted molecular weight: 156 kDa.
    Notes
    WB
    1/500 - 1/3000. Predicted molecular weight: 156 kDa.

    Target

    • Function

      DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Largest and catalytic core component of RNA polymerase III which synthesizes small RNAs, such as 5S rRNA and tRNAs. Forms the polymerase active center together with the second largest subunit. A single-stranded DNA template strand of the promoter is positioned within the central active site cleft of Pol III. A bridging helix emanates from RPC1 and crosses the cleft near the catalytic site and is thought to promote translocation of Pol III by acting as a ratchet that moves the RNA-DNA hybrid through the active site by switching from straight to bent conformations at each step of nucleotide addition (By similarity). Plays a key role in sensing and limiting infection by intracellular bacteria and DNA viruses. Acts as nuclear and cytosolic DNA sensor involved in innate immune response. Can sense non-self dsDNA that serves as template for transcription into dsRNA. The non-self RNA polymerase III transcripts, such as Epstein-Barr virus-encoded RNAs (EBERs) induce type I interferon and NF- Kappa-B through the RIG-I pathway.
    • Tissue specificity

      Expressed in the brain, in the cortex and the white matter (at protein level).
    • Involvement in disease

      Leukodystrophy, hypomyelinating, 7, with or without oligodontia and/or hypogonadotropic hypogonadism
    • Sequence similarities

      Belongs to the RNA polymerase beta' chain family.
    • Cellular localization

      Nucleus.
    • Target information above from: UniProt accession O14802 The UniProt Consortium
      The Universal Protein Resource (UniProt) in 2010
      Nucleic Acids Res. 38:D142-D148 (2010) .

      Information by UniProt
    • Database links

      • Entrez Gene: 11128 Human
      • Omim: 614258 Human
      • SwissProt: O14802 Human
      • Unigene: 436896 Human
      • Alternative names

        • BC053071 antibody
        • DNA directed RNA polymerase III largest subunit antibody
        • DNA directed RNA polymerase III subunit A antibody
        • DNA-directed RNA polymerase III largest subunit antibody
        • DNA-directed RNA polymerase III subunit A antibody
        • DNA-directed RNA polymerase III subunit RPC1 antibody
        • hRPC155 antibody
        • MGC62420 antibody
        • POLR 3A antibody
        • POLR3A antibody
        • Polymerase (RNA) III (DNA directed) polypeptide A 155kDa antibody
        • Polymerase (RNA) III (DNA directed) polypeptide A antibody
        • RGD1305574 antibody
        • RNA polymerase III 155 kDa subunit antibody
        • RNA polymerase III subunit C1 antibody
        • RNA polymerase III subunit C160 antibody
        • RNA polymerase III subunit RPC155 D antibody
        • RPC1 antibody
        • RPC1_HUMAN antibody
        • RPC155 antibody
        see all

      Images

      • Western blot - Anti-POLR3A antibody (ab96328)
        Western blot - Anti-POLR3A antibody (ab96328)
        Anti-POLR3A antibody (ab96328) at 1/500 dilution + HCT116 cell lysate at 30 µg

        Predicted band size: 156 kDa

      Protocols

      • Western blot protocols

      Click here to view the general protocols

      Datasheets and documents

      • SDS download

      • Datasheet download

        Download

      References (8)

      Publishing research using ab96328? Please let us know so that we can cite the reference in this datasheet.

      ab96328 has been referenced in 8 publications.

      • Choquet K  et al. Leukodystrophy-associated POLR3A mutations down-regulate the RNA polymerase III transcript and important regulatory RNA BC200. J Biol Chem 294:7445-7459 (2019). PubMed: 30898877
      • Frischknecht L  et al. BRAF inhibition sensitizes melanoma cells to a-amanitin via decreased RNA polymerase II assembly. Sci Rep 9:7779 (2019). PubMed: 31123282
      • Gilbertson S  et al. Changes in mRNA abundance drive shuttling of RNA binding proteins, linking cytoplasmic RNA degradation to transcription. Elife 7:N/A (2018). PubMed: 30281021
      • Karijolich J  et al. Genome-wide mapping of infection-induced SINE RNAs reveals a role in selective mRNA export. Nucleic Acids Res 45:6194-6208 (2017). ChIP . PubMed: 28334904
      • Choquet K  et al. Absence of neurological abnormalities in mice homozygous for the Polr3a G672E hypomyelinating leukodystrophy mutation. Mol Brain 10:13 (2017). PubMed: 28407788
      • Ogunjimi B  et al. Inborn errors in RNA polymerase III underlie severe varicella zoster virus infections. J Clin Invest 127:3543-3556 (2017). PubMed: 28783042
      • Lee YL  et al. MAF1 represses CDKN1A through a Pol III-dependent mechanism. Elife 4:e06283 (2015). ChIP, WB ; Human . PubMed: 26067234
      • Fontenot E  et al. A novel monoclonal antibody to secreted frizzled-related protein 2 inhibits tumor growth. Mol Cancer Ther 12:685-95 (2013). PubMed: 23604067

      Customer reviews and Q&As

      Show All Reviews Q&A
      Submit a review Submit a question

      1-2 of 2 Abreviews or Q&A

      ChIP abreview for Anti-POLR3A antibody - ChIP Grade

      Excellent
      Abreviews
      Abreviews
      abreview image
      Application
      ChIP
      Detection step
      Real-time PCR
      Sample
      Mouse Cell lysate - whole cell (3T3 Fibroblasts)
      Specification
      3T3 Fibroblasts
      Negative control
      IgG
      Type
      Cross-linking (X-ChIP)
      Duration of cross-linking step: 10 minute(s) and 0 second(s)
      Specification of the cross-linking agent: Formaldehyde
      Positive control
      tRNA leu & tRNA ser
      Read More

      Ms. Jennifer Blancas

      Verified customer

      Submitted Jan 20 2014

      ChIP abreview for Anti-POLR3A antibody - ChIP Grade

      Good
      Abreviews
      Abreviews
      abreview image
      Application
      ChIP
      Sample
      Human Cell lysate - whole cell (Raji)
      Specification
      Raji
      Type
      Cross-linking (X-ChIP)
      Duration of cross-linking step: 10 minute(s) and 0 second(s)
      Specification of the cross-linking agent: Formaldehyde
      Detection step
      Real-time PCR
      Positive control
      Primer set for tRNA-Leu 5'-GTC AGG ATG GCC GAG TCT AAG-3' and 5'-CCA CGC CTC CAT ACG GAG AAC CAG AAG ACC C-3' from Johnson, S.S. et al Molecular Cell
      Negative control
      IgG and primer set for Alu on Chromosome 10 5’GATTCTCAACAGCAGAATTCCATGCC3’ and 5’CATGTTTGAGAATGTCTACTTCTTAG3’ from Zeng, W. et al 2009 PLOS Genetics
      Read More

      Abcam user community

      Verified customer

      Submitted Jan 16 2012

      Please note: All products are "FOR RESEARCH USE ONLY. NOT FOR USE IN DIAGNOSTIC PROCEDURES"
      For licensing inquiries, please contact partnerships@abcam.com

      Get resources and offers direct to your inbox Sign up
      A-Z by research area
      • Cancer
      • Cardiovascular
      • Cell biology
      • Developmental biology
      • Epigenetics & Nuclear signaling
      • Immunology
      • Metabolism
      • Microbiology
      • Neuroscience
      • Signal transduction
      • Stem cells
      A-Z by product type
      • Primary antibodies
      • Secondary antibodies
      • Biochemicals
      • Isotype controls
      • Flow cytometry multi-color selector
      • Kits
      • Loading controls
      • Lysates
      • Peptides
      • Proteins
      • Slides
      • Tags and cell markers
      • Tools & Reagents
      Help & support
      • Support
      • Make an Inquiry
      • Protocols & troubleshooting
      • Placing an order
      • RabMAb products
      • Biochemical product FAQs
      • Training
      • Browse by Target
      Company
      • Corporate site
      • Investor relations
      • Company news
      • Careers
      • About us
      • Blog
      Events
      • Tradeshows
      • Conferences
      International websites
      • abcam.cn
      • abcam.co.jp

      Join with us

      • LinkedIn
      • facebook
      • Twitter
      • YouTube
      • Terms of sale
      • Website terms of use
      • Cookie policy
      • Privacy policy
      • Legal
      • Modern slavery statement
      © 1998-2021 Abcam plc. All rights reserved.