Methylated DNA Immunoprecipitation (MeDIP) Kit - DNA (ab117133)

Both of these kits (ab117133 and ab117135) will immunoprecipitate methylated DNA. The ab117133 Kit uses purified DNA as starting materials while the ab117135 Kit uses cells as starting materials. I can confirm that the immunoprecipitated products are suitable to use for RT-PCR.

The 24 or 48 tests correspond to single immunoprecipitations and not to the number of samples that you are able to assay. Therefore, if for one cell type you need to do 6 tests, then you will be able to run 4 cell types with a 24 sample kit. The kits are in strip format though, so you can save what you don't use for a later time.

With regards to a hydroxymethylated DNA kit, we have https://www.abcam.com/episeeker-hydroxymethylated-dna-quantification-kit-colorimetric-ab117130.html, Seeker hydroxymethylated DNA Quantification Kit (Fluorometric) (ab117131) or https://www.abcam.com/episeeker-hydroxymethylated-dna-immunoprecipitation-hmedip-kit-ab117134.html.

The more suitable kit would depend on what type of information you want from your samples. The ab117130 and ab117131 kits will allow you to look at global hydroxymethylation levels of their samples and would tell you the percent of hydroxymethylation of your DNA but would not allow for RT-PCR. The kit ab117134 will allow the you to explore regions of hydroxymethylated DNA by immunoprecipitating/enriching the hydroxymethylated DNA followed by RT-PCR or hMeDIP-chip which is maybe more useful to you.

You can indeed purchase the anti-5-hydroxymethyl cytidine antibody (ab106918) and use it with the 5-mC immunoprecipitation kit since you coat the antibody on the wells.

Here are the sequences for human H19ICR and GAPDH:

H19ICR(234 bp length of amplicons):

F: GAGCCGCACCAGATCTTCAG
R: TTGGTGGAACACACTGTGATCA

GAPDH (110 bp length of amplicons)

F: 5'-ACGTAGCTCAGGCCTCAAGA-3'
R: 5'-GCGGGCTCAATTTATAGAAAC-3'

Thank you for your inquiry.

With use of this kit, about 40 ng/well of meDNA can be generated from 500 ng of inputgenomic DNA. Thus, at least 20 ug of genomic DNA (in 40 wells) are needed for generating 1.5 ug of methylated DNA.



Based onyour feedback, the WGA method is used for amplification of the yielded methylated DNA from 1-2 well ( about 60-80 ng). The amplified DNA is then used for microarray.



I hope this information helps. Please contact us with any other questions.

Thank you for your inquiry.

You will need 1 well per plate dedicated to the negative control if you're running all at the same time. So for 60 samples you'd probably need to orderone 48 sample kit and one 24 sample kit. The kits are in strip format though, so you can save what you don't use for a later time. This would allow you to do 2 negative controls (1 per kit run) and 70 samples.

I hope this information helps. Please contact us with any other questions.

Thank you for contacting us.





The pre-sonicated DNA sample can be used if the DNA is in the buffer(such as TE containing low concentration of salts) that would not interfereantibody binding to the meDNA, or use MC2 to dilute the DNA.



I hope this information is helpful to you. Please do not hesitate to contact us if you need any more advice or information.

Use our products? Submit an Abreview. Earn rewards!
https://www.abcam.com/abreviews

Thank you for contacting us.
The elution buffer EMD6 used is RNAse/DNAse free water.
I hope this information is helpful to you. Please do not hesitate to contact us if you need any more advice or information.
Use our products? Submit an Abreview. Earn rewards!
https://www.abcam.com/abreviews

I am sorry this product did not perform as stated on the datasheet and for the inconvenience this has caused. As requested, I have issued a free of charge replacement for one EpiSeeker methylated DNA Immunoprecipitation (MeDIP) Kit - DNA (ab117133).

To check the status of the order please contact our Customer Service team and reference this number.

Please note that this free of charge replacement vial is also covered by our Abpromise guarantee. Should you still be experiencing difficulties, or if you have any further questions, please do not hesitate to let us know.

I wish you the best of luck with your research.

I apologize again for the incorrect information given originally.

For tissues we recommend, ab117136.
In comparison, kit ab117135 would be used when starting with cells. When using a DNA sample, please use ab117133 instead.

I hope this information is of general help nevertheless.

Please let me know if you have any further questions.